Description :
From Genome Similarity Track
Location :
Scaffold_194:48086- 51160
Transcript NameFunction/comments
Physo_144531hypothetical protein

Sequence
3074 bases(100 bases per row)
AACAGGTTGACGTGGATCGTGTCGGACGACAGCAGCTCCGGGTCGAAGTACAGCGCGTGCCAACGCTGCCGAATCGCAGACACCACTTTGGTCACGAAAA
AACCCTGCGCCGCCTTCGTCTCGTTAAATGGGATCGACCCTTGAAGCAGCGAGCTGCTCAGCCTGCAAAATAACACATTAGATAGTCAACCTTTAAGCAG
CTTTGCCTCAATCTCACTTACTTTTCGTAGTTGACGTAGAGCTGAAGGTTGTTGGGATCGATCAGCATGCCGCACCACGAGATGCACCGCTCTGACTCTG
ACACGCCCGAGCCCAAAGCGTGTTGCTCTCCATCGACAGCTTTGAAATTCGCTTGACTCTTGGCTAGGTTCACGAAGCACCCGTACTCCTCGTTTCCCTC
GTGCATGACGTCGAAGAACCTTTGCGCTCTCTTGAGTTCCGTCGTAATGTACATGAAGTCGTCGGTGTATCGGAAAAGCTCCTCGTGCTGGCAGCAATCG
ACTGGTACGATGGCTGGGTCGCATACCTCTGGGAGTCGCTTGCGGAGTACGCGACGCTCGAAGTGGGCGTAGTACAAGTTGCACAATGTCGTGGAGAGCA
CAGAACCTTGGGGGATTCCGCACTGCTGGACGTAATCGTGGCCGTCGATCTGGACGACGTTCGCAGACAAATGTTCCTTCAGCAACTGGAGCGCTTTCGT
TTTGGTGAGGTAGTCGTAGATGACCCCGTCCACGAACATCGAGTTCTTCTTCGTTGACTGAGCGGCCAGGTCGTCAAAGCCAAGCAGTTCTCCAGACGGA
TACGCCGGACGCTCCAGCTTGAAGAAGAACGGTAGTGACTCGTCACTATCTGCAGACGTCGGAGCTATTTGGTGGCCAACCCAATGCTTCCGGATCAAAT
ACTCGTCCTCTTGTATCGCCTTCTTGAGCATCTGATAGAGCTTCCGCGGCCGAATTGTATCGAAGCAGCGCTCGACGTCGACACTCACGCAGTAAGCCAT
CGGGGTATCTCCACCGGATGCACGTCGCCGTTCTGCACAACGCGAACAAGTTGAAATTTCGCGAAAGAGAGGCTTGAGGCGCTTGTAGATCTCGTCAATG
TTTCGGACCGAGGCTCCAAGAAGTCGCTTTGGGTGGCGCTCCATTTCAAAAGTCAGCACTCGGTGAACTGCCTCCATAGATCGATTTACTGATACCTTGC
CTTGCTCTACAGGCGTCGATAAATTCATCAATGGTCGAATTCCACTAGATTTCGGAAGCAGCCGCAGTCGAGATGTAGATAACTGGCGGTATTGTTCGCT
CGAAGGTTGAAGGATTCCTCCCTCCAAATCATCCAACACAAGAGTGCTACACAAAAAATTGAATAAGTAAATGAGAACTGAGTAGCACGTTGTTATGTAA
GCGTACGTACCTGATCACATTCCAGACCGGACGCTGATAATATGCGATCTCGTTTGCCATCCCTTCTGCCTCTGTAATGTAAAACAAGTTTCGCAGCAGT
GTGAAAACCAGCGATGAGATTACCCACCACAACAAGTCCTCGAATAGCTGTTGACGCTTGACTCGTTCGTTGGGAGGACTAGACACACATTGAATGATAG
ATTAGGCATTTGGACCCTACTTGTGCTAGGGAGACTGAGAGCAGCATACCAGAATTTTGTGCCGGGCTGCAGATTCATCCACTCCACGGTCACAACTTGA
AACTCTTCCGCACACTTGACAGAATATAGCGTTAGTAAAGGTGAAATTGTAAAACTACAAAGTCCGCAGCTTACCTTTTTCAGCGAGAAAACGTCGAACT
TCCGCGAGAATATGAGTTTGCGCAGCATCGACTTGACGCAGCTCCAGTTCTTCTTGTTGTCGCTGCTACCCCAGAGTTCTTTTGGGACAACTACAGCAAC
GAGCTTACGCACCAACCGGTAAACTTTCTTCTTCGAAACCGAAAAGGCCAGCAACTTTTTGATATCCTCTTTGTGTTGCTGCAGCTTGGTCAGGTCCGAG
GTCCCGTGGGAACTGCGCTGGGCGTTCGTCTCATCAGCGGCCTTATGCCTCTTACCAGCGTGCCCAGCTTTATTCTGATCGTTTTTCAATGATCCAACCG
AGACGTGAGATAGCATCTCGATAGCTTCTTCTCTCCGTTTGCGCTTCCGATCACCGGTGGGCCCGATAACGTCTTCACTTTGGCTCAAATACCCGTCATC
CAGCGCTTTGCGCACGATCGGAGGTAGAATGGGCTGAGAAGAATCCTTCGCCTCAGCAGCCTTCTCTGCAACTTTTACCTTGATCTTCGGGTTCTCCGCC
ATGAACTTTCGGAACTCCTTGTGCACCGGGATTACCTTTTCAGAAAGCTCTTCAACTTTACACGCCTTGAACCTCGACACCATCGCCTGTACCATCGGAA
TGAGGTTGATCAGTCGCTTCGGCAGTCGCTTTTGCCCTGCCGCTTCGGGAAAAATCGACTGCAGCACTCGAGACGCTTCCGTTCGACTGATCGGGTCGCC
CGTCTTGGACGCTTTTACCAGCACGTGGGAGCTCGCAAACACGCGATCCTTTTGGAAATAACGCGCATACATCACAACGTTGATAGACACTTTACGCTTG
GATTTATCGGCGCCAGCCTTGGACGTCACTTGATTCTGCTGACGCAGACTTTTTCCAGTGAGCTGACGAGCAACAGCAACACATACATGGTCAGCATCGT
ACAGAAGTCCCGCCTTCTGCCCCAGTAAGCAAATACCTGCATGTAGGACCCTGGAGCCCCTTGAATTTGAACAATGATCGTGTAATTCAGCAGCAGATGC
GTCATGAGGTCGTCGCCCATGAGTTGGTGCAGTGATCCCCACAGCGGCTTCTTGAGAGCAGCTACGAGTGTGTTCGGGTAGTAGCACATGATCGCGTTGG
ACTGCGTGACGCGGTGGCCTGCAGCCCCTGGCGTCACCTCTCGGTACCCAAGCGTCAGAACGTTCGCGCCCTCCCAGTTCATCGCTCGCTTCCGAGCCAG
AAGCCGCTCGATGACATGGAGGATCAACTCCGTCTGAATGCCACAACACCAAATGATACAGTCAGTACCCCAAA