Description :
From Genome Similarity Track
Location :
Scaffold_578:4808- 18798
Transcript NameFunction/comments
Phyag_g6778hypothetical protein
Phyag_g6779hypothetical protein PHYSODRAFT_476843
Phyag_g6780hypothetical protein PHYSODRAFT_344165
Phyag_g6781conserved hypothetical protein

Sequence
13990 bases(100 bases per row)
AAAGCCCGGCTCAACGGGCGCACAAGCTTACAACAATTTCACCAGAGGAAAACTGCGTACTCTAGGATGTGATAGACCAGCGACTGCGGCAGGTATCGCC
ATCGAACAGGGTCTTCGTCTGCCCCAAATGACCCCGTCAATGCAGCAACCAGGCGCCAAAATCGCAGCATTGCCTCGTCCTTCCAGCCCACAACCGCTAa
cgacgatgtcgacgtTAGCAAGTCGTTAGACTGTTGTTTCTCGCATTGCCGCATGACCAACACGTTCGCGTAGACCACAAGTCGACATTTTTCGCGCTCG
GATGGTGGGAAGTGTCGATGTAATGTCGGGCTCCACACCACACTCCATTCAGGCGACAACATGATCCTCACGTCAGTGCGAATCCAAGTCGCGATTTCCA
CCTCCTGCCAGAGTTCGTTTGCTGCAACGGGCAGCAATTGTGAAACAAGAACTGTTAACACATCATCTCCTGAGTACTCAACACACAAAAAACACTTACA
TATCGTCGCGCGAGACGCTCcattgcgcagcagcaaagtcaCCAAGGAATTGTTCTTGCGTGAAAGTGCCAGTGTCAATGCCGATGTCCCCAACCTAAAC
ATCGCCAAAAACACCATTAATTTCTGCATTATACTAGTAGTATCCACCGTCTAATGGTTGATGAATTACATCGTGGTGGCGTTCAGATCAATGCTCTCCT
CTCTCAAAAGTCGGCGGACAACGTCCATGCGACTATTTGCCACCGCGtagtgcagcgccgtccacCCCTCGCCCATCGTCGCGTCCACGTCGCCTCCTGC
GGAAATCCACGCATCGACGCCCTTCAGATCGCCACCAGCCGCCGCGTCCAGGAACGCGCGCTGCTTGAGGCGGCGCTCAACAGCGTCTCCTTCCTGCATT
AGTGCCACGTGAATCTGTAATGATGGAGCAGGTCACTGAAACGAGGAGTGACTAacttcaactacaacaaCCAATGATGCATCACGATTTTTATTACAGT
AAGGCCATGTTAACTACGTAATCCTTGTGAATGGCCTGAAATTGTGGGGCTGCCAAcgccttcctcttcttcgcggagttcgtcatcttcttctccactt
gaACCTATTGTGAATTTCGGCGACGAACCCTTTCTTGCAGCTCGGGCTCGAGGAGACAGCGAACTTCCTCGTGGAGACAACGGGGGCGACAGATCTCTCC
TCTCGTCGATGTCCACAATTGTCTGCATATTCGCACGCGAGGTTTCTGCCGCATCGGGGATACGGGACCATGAACGTGTCCGCCACTTCGTCCAGACTAT
GACGCCGAGAGCTACACCTACCAGCGAGATGAGGATAATTTCAGCGATAAAGGCACCGAACTTGGGGCTCGATCGACTTGTCGTCTCCCCGGTGGATGAA
CCGGTGGTCACATCGACACTACTAACTGCATTGTCCAGTGCTGTTACTGTTGTGTTCGATTCCACAGGTGAACTGTTGCTTGAGgctgctgatgctggcg
GGTCGGTGGTATTTGAGGCGACCGGTGCTGAGCTTTCGGTTGCTGGTTGATCAGTAGTTTCTGATACAAGTGGGCCTGGGGTGCTAGAGTTATCGTAGCC
CTTCCCTGTGAATAACCAAAAAGTAGCATAATATGTCAACTTAACATGCCGTGGTATCTTCTTGAGCAATACGATAGTGACGTACCGCAATTCGACTCTG
CAAAACCCACGCGCTTGTTTTCTGCATCGAATATCACGTCGAGTCCGACCATGGTGCTCGCACCCAGAACTGGTAGAACGAGAAAAATGTTAGAACCTGA
AGAAACATGTACAAGGAATGCGGTCGAGAAGCTTACCTCCGCCACTTCGCTCCGAGAAATGAAAGTTGCCGTAGAACGAGGATGCATCATCGTCTGAAGG
AGTCAAATATTTTGACGCAGGAATGTCCAGCTGAACGTCGTCAGTGCCATCCCCTTTCATCCCAGACAAGATAATAGAAATTATCGGCAGGGCTGCTAGG
TCATCGGCGGAAAGCTTCATACGCTTATCACTATAATCCCGGCCACCTGCCGCATCCCGGAACGCTTTCATGAAATTGCGGTTTCCTTTTGCGTCAAAGA
ATGTGTCCGTTGTGCCGCTATCAACAATCACCCCTCTGCCTGAGTTGATCGTGCTTTGGACAATTCCTAGTGACACACCGTTCACAAGGATGTCCTTCAC
GTGAACCGGGTAGTACGCGGAGTTGTCGTTGAGCAGCGGTGTGTAGCCCACGTTGCTCGTGTGGTGGCTGTAGTCTACCCCACCAAACACAAGCTCGCCT
CCATCTTTCGCAAAGCACAAAGTGAAGAGGTCGTGCGTCACGCGACCGGCATTCAGCATGTATGACATGACTGTCGCCTTATGGCGTCCGAGACCCATAA
TGCCATTCTCTTTCTGCGTGATAAACAGACCAGTCTCCTTAGTCTGGCAGCCGACAGGGAATCGAAATCCGAACGTCTTCAGAAATCCTTCCATCTCGTC
ACCCGGTGAAGAAAACCCTCCCACCCACACCAGCTCATCAATCATAACAGCCTGCCACATGCTACCTTCCATGTAGCTCTGTCCATTGAAAACAATATCA
TCCATCACAATCGTGAGTACAAAGCTCACATCCAAAATACCGCAGGCAAAATCCTAATACCTGAGAAATATAGCAGCGGTCTTGCTCACACGAACGGCAG
GAGTTGAAGTCGTGACACGCTAGATACCTTGCAGTCGTGGATTTCGCTACATCGAACAATGGGTCCGTGTGAGTTCCGCAGCCATTGCACGTGCTGCACG
GTAACGCTGTCATGTGACTGCCAGTATCCACGATAACGGAAGCTCGTTGCGCTGGTATTCCCAAGTAAATCTCAGCGTAATGCGTGCTGCACAGCAGAAA
AGCGTAAGATACCTGTTCTTAATCCTATTCTAGAGCCATTGTCATGATCAATTCTCGTACCCATAGCCCACACCTAATGGAGATTCACTTAGAGCAAAAG
TCCCTAACGCATAGTCTCCGCCCGCTTCCTCCTGAGCTCTccttcgagctcgagccTGTTGGTGTGCCAGTCGGTGGGAGAGGTCTGTagtcggctgctg
ctgcttgtggagCAGGATTTTCAGGAAACTCTTCTCGCCAGCTACCAGTAGAGGGGCTTGAGAGCAAATTGCAGCTGCTAGAAGAGCGAGAGATGCACGC
CAGCGAGCTCCATGCGCCGCGCGTCGAGGCTTCATCGTCATTGCTGTCAATCGCCGCAATGGAGAACGCACCAATGCAGCAAATCTATTTTTAGGTTGCA
GCAGATCTATTTTTAGCCAATTAAGGGATATATCAGACGCGTTTTCCGGCAGTCCGGATAAAGGTGCTCGCGTCATTTAGGACATAGGTACATTTAGGAC
AAGCATGGGGATGTTTATTGAGCTGCGGCGGTACTGAAAAAGTTAAAGCCGCTCCAACGTGTGATTGTCGACCTTCGATTCCTCCTGCAGAGAGGATTTC
CGGTCGAagacctcgtcctcctcgtcgctgctgctctggtgatcgtcgtcgtcatcttcctgatcaagtcgctggtGTTTTGTTGTGGgcttctgcttgt
cgttGCGAACGAGGCcaaactcttcttcatcgtcgtcgtcctcatcttcttcgtcgcccTTGACACGACTCCAGAGCTGCTCCTTGCCATCCTTCTGTCT
CCGTCTGCTGACTGAAATCAGCATCATCAACAGGAATCCTACCACCAAGACAGCGCCGACGATCGTGAGCACCATCGGGTGAGCGCCTCCTGATgacttc
tccttcgtcgtcgagtcTCCCGtggcagctgaagaagacgactcGACAGTTGTTGGAGTCTCGTCCGACAATGTCTGAATATTAGGTTCTGCAATACTTG
AAGCAGCGTCCTGAGCCGAAGTATTCGCGTCAACCACTACAGGAGTCGATGGCTTCGTCGCAGCCTGCTCTGCAATAACTGGTGCAGTTGTAGACTCCGA
TGTTGGCGCCactgttgcagcagtcgttGCAGTGGGCTTTGAGGTCGCTGCAGCGGGGGTTGGCTTCGAAGTCGATGCCActgttgttggcgatggagtt
GTAGCAGcgactggtgcagcagtgtcaGATACCGTCGATGTAGCACTAGGGACGGCAGTCGCCGGAACTGCATGGGTCATTTTTCCTTCCGAGAAACTCG
TCGTAGCGTTGCCAACTGCCGGTGCAGCAGTCGAGTTAGCACCTTCTTGGTAGGCGCAGTTTGCATCCACAAAACCCACGCGCTGGTTGCCACTATCGAA
AATCACATCACGGTTCATCATGAGGTTGGCACCAATAACACCGCCCGAGTTCTCCGAAAGATATATGCCACCACAGTAAGCGCCATTTGTCTCCAACAAG
TACTGCTCGGGCGGCACATCCAGGACCACTTCAGCGTTTTCGTCTCCGTACGCTTCCATCACAAGCTGGATCGTGGGTAACGATGCCAGGTCCTCGTTCG
TAAAGCCGTGACACGAAGTTCCAACCTGGTAATCACGGCCCGAGACTGCCTTAAACGCGTCCAAAAACTCGGTCTTCAGAGCGCGCGGGAGATACGAGTC
GGTAGTTCCGCTGTCCACAATGTAGTGTCCGCGCGTGTAAGCCTCTTCCTTGGCGTTGATGGATTTACCACCAATCCGAATGTCCTTCATCCGCACGTCG
TAGAAATGGCTGTTGCAAGCATAACACAATTAAACACTTAGAACAACCAAAACAATCGCGCGCACACAAACAAAGCGTTCTTACCCGGCCGATCGGTCCG
CGATCACTTTCGCGTACGAGATTTTGCCCCGGTGAGCCGCTGTGTGTGCCTGGCCAACAGACATCGTGCCGCCGTTCTCTGTGAAACAAAGCGAGAAGAG
GTTGCTCGCAATCTTGTTCTCGCGGTGCAACTTGGCCACAATGTGGTTGTCCGTGTTTGACAAGCCCATAATGCCATCAGCCACTTGCGTCACAAACAAC
CCCGTCTCGGAGCTCTGACATCCGAACTGGAAGTGCGTTCCATACTTGTTCCGCATCGCTTCATCCACAAAACTCGCCTCTCCTCCCAAGTACACAATgt
cctccaccaccgacgccttccagctgctgccttcCATGTACGACTGGGAAATGCCACACGTGTCCGACGACACTCGGCATTCTTTGCACTGGAAGAACGA
CTTCTGAGTACACGTCACGTGGAtcaacgtggacgagttcttggCTTCGAATGGCTGGTCTGTGTGGGAGCCACAGCCGTCACAACCCGAGCACGGGAAG
GCCATGAGTCCACTGCCAGTGTCTGCGATCACCGACGCTCGCTGCGGCGGAGTCCCTGCATACACCCACGTGTAGTGCGTCCCTAGTCCCAGGTGCAGTG
GGACAAGTTCCGgcgcgtcgtcctcgctaTTCAGGCGTCTCGCGTATCTCTCCGGGTGGATATCGTGCTTGGGCAGGCGGTGCAGCTCCATAGTCATGCT
AGCAGTCTGTTCCAGCGTCGAGAGCGTCGATACGGCCGCAAGAAGCGCCGGAGCGCCGATGAACACGCGAACCATTGTGTCTAGACTCGTCAATGGAAGC
TGTGGAGTACGGGTAAATGGCCTCTGACGGCGAGGAAgagagctgctggttgaTGGGATGGGAGAGCGAACTTCGGCACGTGGCAGTTTTCCTAGGCCTC
TGATCTCGGTTTAGACTAAACTTTAGTAGCGGTGTCGGTTTTTACGCCCGATTTAGCAAAATAGAGTCGGAAAAAAGTATCTTTGAATCCGAGCCTTTAC
TCGATGGTGATCCTAATCTGACAGTCCCATTTCGCTGCGTAGTAGCGTCGACCACGCGTTGGTGCTACGGCGTTGGCGCGGCGAGCGCAATTCATCGTCA
GGGTTTTTCTTGGCGTTCGGTTGCACTGAGAATGCTCGCAAGGTAGCGGTCGAATCTGCCGTTCGACTGGCAAGTCCAGGAATACCAAAGCGAGAGCGAG
GCGACCCAGGTCCTCgaggcgaagcagcagcagtagaatgcttcttcgtgttgttCTGAACCAACATGTCGTGGCGGATTTCGTCCAGTAGTTGCTGGCA
TTTCGGAGACACGACGCGTCGTGATGCCATGAAGACGCCAGTGTTGGCATCCGtcggcactgcagctttcatGCTGAGCAAACGTTTGCGCATTTCGTTG
TCACCTGGACGTCGATGCTGTGCCAATAGTGCAGCGGCTTTTAACTCCACTTGAGAACCATCAACAAGCCCGCTCTGGTTACCACCACTGGCGATGTCAC
CGTCGTTGACAGGAGGGTCACCGTCGAACGGAATTCGGTGGTGTGGGGTTGCCAGTTGCTCTGCAGACATGACGTGGAGCTCGCCTGCAAGTTGCAAGTC
TGCTTTCACCTGTTCGGCACTGTTATTAGAGCCGTGTGCAAAAGGTGGAAAGTCGCGTTGCTCCGCACGAAGCAGTTTGTGTTGACTCCAAGCTGACAGA
AATTCAACCGCCGGTAGTAAAGTTCGATGGTCTTCGAGGCTTTCGTCCACCCAGTCGATCTGCTGCAATTGTCGTTCGAACTCAAGAGCTTCACCAGAAA
GCACACGCATCTTGATTGCCACTGCATCGTCGAGATTTCGAAGTGCGTGTGCACACTGCTCCTTGATGGCAGCAACGACCTGCGCCTTGTTGTCTTGCAC
ACTACGTTGAATCCGAGTCAAGAACTGCAGCTTGTTTTCGATCACTGTTTTTCGTGATGCGATTAGCGGGTCAGGACGCAACGACTCACGCAGACAGCTC
TCGTAGGCATCCGCGACTGTCAGCAGGCGATGAGAACCTTTCTCTCCGATCGAGTGGTCTCCGATCATTTTGCAGCTCACGCACACAGGGACCTGGCATA
CGGGACAATAGAATTCCACTTTCTTGCCGTGGTGAGTACGGCACGGAGGTGTCTGTGCATCGTCGGCTAGCAACCCGTCTTCCATTTGCTTGGCGACGAT
CTCGTTGATATGGGCTTCAGTTGGTTCGGTGTTGCTAAGCGTGTTCAATAGGTTCTCCACGCCTACTTCTGCAATGACAGCAGCTAGAGACGGTGTCGAG
CTGCGACGTCGCCCACGTCTAGCACCTTCACTTGCCAATGTCTTCGATTTACTGCGCATAGGTGTCCGCTTGTGGCGGCGTACCAACTTGTTGGCCGAGT
GAACTTCTTGATCGCAATGTGCGCAGATCTGCGCCTCGCAGTTGCGACAAATAACAACAGCGGGATGTTGTTCACACAAAGCGCATGTGCCAACTGCAGG
TCCGTGTGCATCAGCGGCGGAGAAGGTGAGCCTAACAAGATACTGCGGTAAGACTTGAAGCGTATTGTTCAGGATGTACTCGTGGTAGTAGCCtcgatcc
agcagcgcagctTGCAGGTTGTGGATATCTTGATCCTGAtccgcagcaccagcttcttcatcgcgatGCAGATAGTAGCTGTGGTAACCAGGCGGAAGTC
GTGctttggcttcttcttcgtcgcgtATCACTAGCGATCGCCCCACTGCTATTTTGCAAAGCACAAGCTGCCGTGTGCTCGATGGTTTCTTTGCTTCAAC
CGGAGGGTCAAGAGGTGGAGGTGCACTGAGCTGAAGGTTCCCCGTTGTAAATTTCATGCCCGTTTGGTTCGCATCAAGCGACGTAAATCCGTAGCTGTGT
ACGTCCCCCATGTCAGCGCCAAGATCGTTGACCGCGACCCAGgactccagctccaacaaGCCTGCTGTGTGCTGTTCATACTGCGCCACCAGTGACGGAT
TTCGCATATCCCAAATCACCACCCCGTCGTGCACGCGATAGCCTGGCAACGAGCATTGCAGCAAGTACTTGACACGTGCAAACTCCTTCGACGATTGGCT
CATCGGTGTCACGCTTGCTACTGCCCCCGCGGCAGGAATAGTAGTCGTATGCCcaccttcctcttcgtcatcgtctaGTAGCACTTCGGGACAAGATCCG
ACGTCCGCTCCCCATTCAGTCGGTGGTGGTCCAGCTTGTGAACTACCGTCATCGTGGCCATCATCTTTCTGACCTATGTCAGGTGGACGCTCTGGCGATG
CAGGCCGGATCTCCACTGGTCCATTCGGCGAATGCGACGACAGGAACAACCGCAGCCGAGCCAGCGAAGCGCTCGCCTTCGCCTCGTCGGCCTCATTCAC
CACCATGGAGTTGTGAGCTTATTCCTTTCGTACGAGAAGTCGTTACGTTTGGCCTTTTGGCGATATCCGCCAGGAATACACGCAGTTGTTGGCGAACAGC
GAGTGCAGGGCAAGCATCCGTAGCCATTTTGCTTGCAATGCTACGACGGCAATAGCTTCAACAtacagcttcaacattgATCGGTTGTTTTGGCTCAGCT
CAATCACCGGAACGCTTGTGCTTTCGAATTCAAGGTGAATAGTGGCTAGACCGCTGCAGGTCTGCCTGCTTGACAACAGCAAGTAGGCCGTGCACTGAGC
TGTCATACTGGTACTGCATCGTTGGTGCTTGCAGGTTATACCGGTACACCGTCAGAAACTCCTCCATCCTTCAATATGCTAGGCATCCGCGTCACGGGGA
CTTAATCTCCCTGAAACACCGGGACGATAGCACTCGTATTGCACGGCTCCGTTGCAAAGCAACTTGCATTACCGCAGCTCAAATCTTGAGCGCGCCAAAT
CGGACTAGGCTGCGTCGTCCGTTCCCGCCATCTCCACTCGTCCAACCAATTTAAGATGACCGTTCTCTGGCGCTTCTAAGCGGGTTCGTGTCAAACCCGT
TTCCCATACAAACCCAAGTCAAAATCTCAGCGGGTCCAGAGTCGCTCGACCCGTAGCTCTTCGCGAGTCAAAACGGCGCCGCTGGCTGCCATTTGGCCAT
TAgttggcagcagtggaagtcGCTTCAACTCTACGCACTAGTACACACACCATGAAGTACCTGGCAGTGACCGGCGGCACTGTGAGTGGCCTGGGCAAGG
GCatcaccatcagcagcatcggcgtcgtgctcaagtcgctgggGCTGCGCGTCACGTCCGTCAAGATCGACCCGTACCTCAACTGCGACGCCGGCACCAT
GTCCCCATTCGAGCACGGCGAGGTGTTCGTGCTcaacgacggcggcgagggCGACCTGGACCTGGGCAACTACGAGCGTTTCCTGGGCATCACGCTCACG
CGCGACCACAACATCACCACGGGCAAGGTGTACACGCAGgtgctcgagaaggagcgtcgTGGAGACTACCTGGGCAAGACGGTGCAGGTGGTGCCCCATG
TGACGGACGCCATCCAGGACTGGATCGAGCGTGTGGCGCAAATTGGCGTGGACGGGCAGCACGCTGGCGAGGCCGGcgctgtggacgacgaggcggcCGA
CGTGTGCCTCATTGAGGTCGGTGGCACTGTTGGCGACATTGAGAGCATGGTCTTCCTCGAGGCTCTGCGTCAGTTCCAGTTCCGTGTCGGACCCGAGAAC
TTCTGCCTTGTGCACGTCTCGCTCGTCCCTGTGCTGGGATCTGTGGGCGAGCAGAAGACCAAGCCGACTCAGCACGCCATCAAGGAGCTACGTAGCGCTG
GTCTCTCGCCTGATGTGATCATCTGTCGTAGTAGCACCGAGCTGGAACCTTCcaccaaggccaagatcggCATGTTCTGCCAGGTGCCGGCCAACCACGT
GCTGTCGGTGCACGACGTGAGCAACATTTACCacgtgccgctgctgctgtccaagcAGGGCGCTGCTAGCATCCTGatgtccaagctgcagctgatggaC
CGCTTCTCCGAGCCGGACCTTGCGGCTTGGTCGGCTATGGCCCACCGTGTGGActcgttcgagaagatgtGCAAGATCGCCCTCGTGGGCAAGTACACGG
GTCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTCAAGCACGCTACCATGAAGTGCAACCATGATCTGGAGATTGAGTGGATCGAAGCCAGCGacct
ggaggtggagatgcGCGAGACCGACCCCAAGGCTTACGAGTCGGCCTGGACCAAGCTGCGCAGTGTGGACGGTATTGTTGTGCCTGGTGGATTCGGCGAC
CGTGGTGTGGATGGCAAGGTTCTTACGGCCAAGTACGCTCGCGAGAACAACGTTCCGTACCTGGGTGTTTGCTTGGGCATGCAGGTTGCTGTGATTGAGT
ACGCGCGCAACGTGATCGGCTGGAACGATGCCAACAGTGAGGAGTTTGACGCTGATGCTGGACACAAGGTGGTTGTGTTCATGCCCGAGATTAACCCGGA
GGTCATGGGTGGCACCATGCGCTGCGGTGAGCGCCGCACGATTGtgcacgagaaggaggaccccgcgaagcgctcgctggTGTCGTACCTGTACGGCAAG
GACAAGCCCATTCTGGAGCGTCACCGTCACCGTTACGAGGTGAACCCGGAGCTCGTGCCCGCTATCCGTGAGGCTGGCCTTAACTTCGTCggcacggacg
agaagggTGAGCGCATGCAGGTGATCGAGCTTGACCGCGACGTGCACCCGTTCTACTTCGCTACGCAGTACCACCCGGAGTTCAAGTCGCACCCGAACGa
cccgtcgccgccgttccatggtctcgtcctcgctgccaCCGGCCAACTCGCCCAATTCATGAAGGACgtcgaggccaaggagaatGAGCAGtaagcgacg
acgacgacgactctctggagcagcagatttgCGTGTGAATAGGCTAAAATATTGATTTGGAACCCTCCACTCCGCCGCTTTTGCCTTGTTTTTCTTCCGT
ACGAAGGAAAACGGGGCGAAGCTCTCGCGGTGGGGTTCCACGACGCCAGCCCAGTAGAACTAAACACCAATGCAACATATTTATTCCAACTCCATCCTtc
ttccttcatcttccCCTCTGTTTCATCGTCTTGTttcatcctcttcttgctgacgtACCcccaacatggctacatctgAACTTTTGATCTATTTTCAGCG
AATCAGATCACTCAGAGTGGCACCCGACGTGGCAACAAGCTCACTATCCGATAACGATggcggaagagctgcaagaggcAGTGGACGGCTTCTTCCTGGC
GGCGGAGTACGGCCGCTCCGACGtcatcaaggcgctggcggacCACGGCCGCGGTCGCTTGTCTCTCTCCGACGTGGTGGACCCCGTGACCGGTCGCTCA
CCGCTGCACGTGGCCGTCGCAagcggcaagaaggacgcGCTTCGGGTTCTTCTGGCTGCTGGCTTCCCCCCAGCGCACCAGAGCAAGAAACAGGACGACA
CAGACGAAGAGAGCCGATCTGCATACGCTCTAGCACAGGAACTGAAGGCtcacgacctgctgctggtgttccaTCAGTTCCTGATCCAACAAGTCGCAGC
TAATGACACACACAGCGTCACCCAATTGCTACAGGCTGGAACGGACGTGGGTGTCACAGACGCAGCTACGGGAGGGACGTTGCTGCATTGGGCGGCGTCG
TGTCAAGCGGCGGATGTGATGAAGAGCTTATTGGAGAGAGAAGATgtgcaacaacaaaaattAATTGATGCACGCAATGGAGAGGGCGCGACGCCGCTGC
ACTTGGCGTGTCATGCAGATGCAGTGGAATgtacgaagctgctgttgagcCATCATGCAGATGTTACGCTGCGTGGGGAGAAGGGGGTTAGTAAGGACAA
AACGGCATTGGAAttggcgacgaaggaggaggtgaaggggTTATTCTCGCAAGGCGTTAAAGAGAGCGGTGACGTCGTGAAGGCTAAGGAATATGAGGCG
GTGAAAGGGGATAATGGTGACGAAAATGTTGGAGAGAATGGAGAGACGTCGTGTGGCGAGGGAAGAAGGTCAGCGACGTGTCCGCATGAAATTCAGAATG
GTAAAttgcttctgcagctcgaagagaaGGATTTGCTGGTGAACCAGTTGAAGAAGACTATTGAAGCGCTCGTGCAGGAATCACAGGAAATTCAGATgct
tggagaagaacgcGTGATGCTGGATTATGTCCGTAAGCTGCGTGACGAGAAGGCGATCGTCCAGAggcagcttgaagacgctAATGACTACATTAAgagc
caacaacaacaattgGACAGCTTGAAAGAGCAGATACGACAGATGGCAACGTTGGGCAAACAGGTACGCAGAACGGTAGTTGTACGCGGTGGAGTGGTGG
GTTCTTACGGCAGCTTCTTTTGTGTAGCAGATTGAGACTGACCACGACGTTATCTCTAATACTAGTGATggcacgtccagcagcgccgcagGCCCCCCGG
ACAGCAGTAACAGTACCATGAGTGTTTTGGACTTGCACCAACTCGAGAAACAAGTTGTTGAAGAGGATAACGGACCCCCGAAGCCGAAAGCACAACCGTT
GAAGCTGGATGCCTGGACGTCTAAGGCACAACGTGAGCAAGAAACCTTCAATCGATACGTTGAAAAGCACGGCCCTGACATCTGGAGCACTGTGTGGAAC
GGTATCTGGACAGGTAACGAAGAGACTGAGgcgcaagatgaagacggcgaggTCATCATGACGGTGTAGAATTAATGATCAGTTCAAGAACAAAGTGGAT
GATTTTCAAGGATGCTAAGGAGAAAGAACTTGGTTAGCCGatcggagaagaagcaactGTGGTAgcgtcttgttgttgctgcttgtacACGCTGGCGAGG
AGTTTTtcgcgcttcttcggctgATTGTACAGCGCACAGTTGTTAGCACACTGATCCGAGGTTGAAGTCGAATCTGGACCAGGCTTGGAACACGAGCAGA
GCGGCGGGGTTCCTAACTGTGCTTGAAGAGCTCTCACGAATCGCTCTCGCTCTGTTTTCGTTCCTTGAGCCGTGGGGCTCTTCGCCGACTTTTTTCTCCA
AGGTTTCATTGACGTTGCAGTTTGACGATGCACTCGAACGTCACACCCTGTTATGTCGATCCTGTTTCGAAGAGTGGTTTTGCATGAGTTGTTCATATCC
CTACACAAGTGTGCATGCTCAATCACGTACACTTTGACACCAGTTGGCGTAACCAAATTCCCCCCACGACTTCTGTGCTCTGGGTTATtagctcgacgag
ctctgctgccgcgtgctgctgctgcaactgagGCATTTGAAAGTGAAGGTTTAACTTGGCCCGATTTCAGAGGCTGTGAATCTCCTCGGCAAGCGTTGTT
CTGGACGTTGACTCGTTCCATTTGCATATATTGTCGCCTCACTGTAGCATATAGAGCAACACGCTGGCACAATACCGAATTAGCAAGTCGAAGTTGACAC
CAAAATCTTGAAGACTCACCTGTCCTCGAAGCAACACGGGAGATTTATCTGGTTCactttcgtcgctgtcgttctcgCCACTTTGATTTTCAACGCTGAT
ACTGTCTTGCGAACGAGAAATTTCGGTCGATCTCAGCAAGTCTTCACGAATCTGTGCATCTAAACGTAAAATCTGGCATACATGTATATCGCGTTGAGAA
GAGGACAAACAATTTTTTCAGATACACGCCTTGTACcttttcaatttgctttCCCAAAGGACAACCCTACAGTAAAAATCAAAGGAGACTTTTGTGAGTG
CCCACTAGTTCATGCCATTAAGCGTATTGTCGCCGAACCTTTAGTATAgcgctcttctcctccttcaaTTTCTGAAAGTGTGGACGTGTTGAGACTCGTT
CCTCCGAAGTATGTTCAGTTTGCCGGGTCTGTTGAATCGATTCCGTGGTCGAAAAGAGTTTTGCACATTTTGCGTCCTATTGTCATGGCAATCACGGTTA
ATTTGTATCACTAAAAAATTCGAGGAAGCCAACGCACCAAGTACTTCTGCGCTCGTTGGGCTTCAAGTCGATTTTGCCGTTCTCGCGCCGTCACACGCTC
ACAAATTTTGTCGTGAAATCTCTTTATCTCGTTGGACTGGGCATGTAGACGAATTTGGGCTTCCTGGCGCGCTATCTCTGCTTCAGCCTG