Description :
From Genome Similarity Track
Location :
contig_42:480494- 482574
Transcript NameFunction/comments
g7767.t1hypothetical protein

Sequence
2080 bases(100 bases per row)
GATAAGGTTGGCGATGTGAGCTGTGCCAGAGCTTCATCACCCTAACGACTATCAATCTTTCTCCTGGTCTGTTGTTGAGGAATGTCCCTGGGCTGCGTGG
AGGTGACAGCCTTCTTGGGGGTACCGCACGACTTCTTCGAACTCCCCCCCGACGCCAGCTTCTCCTTCCACTCCCCACTTCCAATCTTCGCCTTCCGTTG
GGGGATATCCTTGGGTCGTGTTGAGCTGCCTTCTTTTCGTGGGGTGTCATTCATCCTCTTTGAGGAAGGCGCTTTCGTGGGGTGACAAACTCCTTTGGCT
CGGTCCGCTCTTCGCTATCACGCTTCGCTTGCCGTCGGGGGAAATCAGTGGGTTGCATGGTGCTTACCGTCTTCTTCTTGATGGTCAACCTCTCAGGGCT
GCCCTCGTTCGTAGTGGTCGATTTCGCGGTGGTTTTCTCCTTCTTGTCCTCAGCCGCAAGCTTCGTGGCCTCTTCGAGTCGGGTAGCCCACATCGTGCGA
TTCCGCTCCACATTGGCGAGGCAGCCTTCTAATCCAGCCAACATGCCTCCGAGCGCACGCCACAGAGGGAACGCGCACGAGTCGACAAACGCCAAGTTAA
CACGCGCAAATTCAGCCGATCCGGGCGAGCATCCATGAAAGCCGTCGCTGAAATCCCCAGCTCAACCTCCTCTGCATGCTGCTCATTGAATTCTTCTAGC
AGCCTCGTCGTCCAGCGGAAGTGCTGCTCACAGGACTGAGTCGGGCCCGAGAGGTCTGCCGAGTGCACAACAGCACTCACTAGCAGTTCACGCAGGGCCT
CGTCATCGTTCCGGCTCCCACGGACTTGAGCTTCGTGTACTTGGCTACAATGCTAGCGTGGCGATGCATATCAGTGGCAAGAATCGCGCGATAATGCGCT
TGCGAACCGCACGACGGCTTCCAACAGTGTCACTCGAGCCATCCTCCAAGCCAGCCAGCACATCATTGCCATGGTCTCGAAGCATGCAGCTGAGTGCATG
TTTTCCAGCACGGAGTGATCGTTATAACGACGAGCGAGGCGCGAGCTGCACCTCACGTGAAAGTCGTTGGTTCTGGCGTCGTGGCCCATGTCGTGACAGA
AAGCTGCCACGAACACTGCAAGTCGCTCTCGAGGAGCAAGTATCAGTTCGCCGCAACGTTTCTGTCGGCTCCGCTCTGTGGCCTGCGCCTTCGTGGTCGG
ACTCACTCCGAGCGCAGTGGAAGCGGGAATCAGTGACGAAGCCAGCTTTTTGCTCTGCGCAGTGAGCATGAGGAACGTCGTGTGCAGCGTGGCGAAGGCA
TGGTACGTGTTGTGATACGGCACGTCAAGGTACTGGGCCTGTACGCTGTGCAGGAAGCGGCGTAGCGTGGCTTCCGGCAGTGCGAATCCATCCATGAGGT
CGTGCAGCTCGAACATGTCCACTGCGAGGTCAATGAGCTGAGCCGGCGAGAACTGCCACGGATCCAGGTCCCATTGTAGGGCCGGGCTTTGCGTGCCTTG
ACTTGATGCAAGGCCAATGCTACCGGGAAGCGAGGCGAGCATTCCACATCCGCCGCTACTACTCAAGAAGCAGCGTTCGTGGTACGAAGTGGCAGCTACG
ACTGCTGCAGCGTGGTCATGATCACTCACGACGGATGGAAGGCGTGAACGCGGACGACGACGACGGCGTACGGGAGACGCCGTCGTGTACTGTGCAGGAA
CGTCCGTGTCACGTGGCTCTCGCCTTCGCTGTCGCTGCTTTCGCTGTCGTCATACGACGGCGACTCGAACACAAGCTCCCAGGCACGACGCTCCACAAGA
GCCGAGAGTTCCACGCAGATAGCACGTAGCACTTGCTCGTCTTCCGCGTCAAAGCCCTCGGTCTCGCCGCTGGCGCTCATTTTGTTAACTGCGTAGAACA
CGCCGATAACGGGGCGATCGTCGCCGTCTTCGTCGGTACTGCTGCTCGTACTGAAGCTGCTGCTGCAGCGACGTCCAGACCTCCCAGAAGCGCCTGAAGA
TGCGAACGGTGCAGTAGACGACGAAGCTGACATAGATGGCTGAGCCTTGATGGGCACACAGCAGACTCGACGACTGCATA