Description :
From Genome Similarity Track
Location :
contig_38:480395- 482552
Transcript NameFunction/comments
g8428.t1hypothetical protein

Sequence
2157 bases(100 bases per row)
CGCTCAAGGAAGCCCAGCACAATGCGCTGGATGGTGCGCGCCTCGTAGTACATGAAGTCGGACTTCATGGCCTCTAGCTCTTCCATCACACCGTTCTTGA
AGTAGATCAGCGTCTTACCCATTTGGTACTCCAGCGGCGACTTGCGCCCGATCGACGTCATGAAGACGCTGCACGTGCGGCGAACATCCTTGCTGTGCAT
CGATGGCGGGAACATGATAGCGTAGCGCGTGGCCAGCTCCTTCGGAGTCAGACGACTCGGGTACCCGGAGCGTGTGATACGAATGGCTTCGATCACACCG
GCCGAACGCAACTGCTCCACGATCATACGCTTGTTGAATTCCGTCGGACTCTTGTTCGAGTTCGGCTTGATGCAACGCACGTAGTGCGTGTTGGTAGTCT
TGATGTTATCCATCAGCTGGGCCAGCGACGTCTTGAACTGAGAGCCCAAACTCTTTGGGCCCTTCTTGCCGCGTCCGCTTCCGCCTTCCGTCACAGCCTC
GCTGTCCTCAAAGAGCTCCGGCAGCAGCGAGACGCTGCTTAGCTGGATCAGGTCGAGCAAGTCCTTCTGCAACGTATCCCGGTGCTTCTCCATGAAACCC
ACCGTCTCGTACGTGACGGGGCCGGCGTAGTGGTTGACGATAAACTGCGTGCGCTTCACCTTGGGGAAGTCGATACTTTCGTTTGCGTTGCCGTCCTTCT
TCGTCTGGTGATTCGTGCGGATCTTGTTGACCAGGGCCTCTTCCGTGTCACGCGGCTGACGCAGGTGATCGTTCATCAGGGCGATAATACCCATCTTACC
CTCGATCACCTCCACAATGCCTTGGTTGTCCTGGTACTGAATGTGATCCCACTGCAACCCTTCACGGATGTACTCGTCCTCGACAGTCTTGAACACATCC
GTAGTGAACTTCTGCTGCAGCTTCTCGTTCGCGTAGTTAATGCAGAACTGCTCGAAGCCGTTGTGCACAAAGTCCTCGAAACCAAAGATATCCAGCACAC
CGATCTGACCGCTGATACGACTCTCGTCCGTGCTGATGGCAGCGTTGATCTTCACCACCATCCAGTCGAACATCTTCGAGTAGATGGTCTTAGCCAAGGC
ATCGCGGTTCTCCGCCGCTTCCACAGGAGCAAGCGGCACCGTCACGCTATCATTGCGCGTGATGACCGTGCGGTTGCACAGCGCTTCCTCGATTCTCGTC
GTGGGAAGACCGAACATCTTGGCAACCTGCGACAGAGCAGAACCGCTCGAAATACTTGAGCCCTCCTCTCCACTCTTGTCGAACGTCACCTCACCCAGCA
GCAACACACCAGCCAAAAGCTTGAAAAGCGTCTTCTGCGCGCGGGCGTCGAGACCAATAATCGACAGCGACTTTTGCGTGCCAGCAAACCACTTACTGTC
GTCCAGACCAGGAATCTGCATCTCGGCAAGCGAACCCGCGTACTGGTACTTGCAATCAGGGTCCAGTCCAAAGTCCTTTAGCTCGCGGCTAGAAAGACCC
GCAAGAAGCTGGTAGAAAATGTGGTAATTGCGCTCGCCCTCTGCAATTGACACCACACGCGACTTCTCCAGCAAATAGGTCTCGCATTTCGCGCCGATCA
GCTTACCACGGTTATCGAACTGCAGCTGCGTAAACTTACCGAAACGCGAACTGTTGTCGTTACGTGTCGTCTTCGCATTACCGAAAGACTCGAGAAGCGG
GTTGACATCGATGACTTTAGCAATGGTCTTGTCCTTGCGACCACCAGCCACACTAGCCAGGTGGTTCATCACAATTTTCGTCGTTTCCGTCTTACCAGCA
CCCGACTCACCACTCACAAGAATACTCTGGTTCATCTCATTGGTTTTCATGTGCTTGTACGCCGCTGTTGAGGTTGAGTACACGTGAGGAGACAGTGAGT
CACGCGGCTTTCGCAGATACTCCTCATGCAGGTGATCGCCATAAAGGTTCTCGATCCACTTGTACGGGTTCAGAGCAATCACGATGTCGTTAGTGTACGT
GTAGGGCTTTGAGGCAGCGAAGCGCTGCTTCAAATTGAACAGGATTGACGGCTCGTTCAAGTAGCGAAGCAAACGCATATCCTCAACGCCCTCCGGGTTG
TCGTGGAGAATGGCAATTGGAAGAGATTCCACTTCAGTCGCCGTCGGTCCGGCAACG