Description :
From Genome Similarity Track
Location :
contig_15:480246- 481424
Transcript NameFunction/comments
g4261.t1hypothetical protein

Sequence
1178 bases(100 bases per row)
GGTGGTCTGTTGCTCGGCCACGATCCGAAACCCGGAAGCACACTTCCGACAACTACTGCCGTCGCTTCCGCCTCAGCCCGTAGTTGCGCCTGCGAGTGCT
CCTACTGATGGCAATCCCCAAGAACGATCAGAGGAGGAATTGGGCCCACCCAACCTGCATTTTTTTCGCCAGCGCCCACTTCAGGTTATCACAAAGGACG
GAGCTCCGTCTGTAGAAAAACTATTCTGTGTCTGGAACCCAAAGGTATCTAAGAAGAAGAACGTGAAGCAAGTGGAGACCGAGCGTGATGAACCCAATCC
ATCACAACTTTCTTCATCTGCGTTGGCGTCAAGAAAACGCAAGCGTACCGAGGGCACACCGAACATATCGAAGTCCAATGATGAAGATCAATCCAGCACG
AGCACCAGTGCGATTTTTCAAGGAGCTAGAATCCTTGGTCGCTTAGTGGAAGCTGAAATCGCTACACTCCTGTTCTGCCGGGGGAGAAAACTAACGGAGC
TGGTATTGATGAATCTCCACTCGATTCTGAAGGCCGATGCTAGCACTCAGAATCTGATTCATCGGGTTTGTTCCTATCGTGGTGGGTATACTCTGGAATC
CAGGCGGCGGATTGAGCAGCGACTGTTTAGTGGAGATTTGCTGGGTGTTGTGGCAACGAACGCTTTGGAGTTGGGTATTGATATCGGCGAGTTGGACTGT
ACTATACATCTTGGACTCCCATCGAGCGTCGCGTCCTTGTGGCAACAAGCCGGTCGTGCAGGTCGCCGCCAGCAGCAATCTAAGCAAAAGCAGTCTGTAG
CGATCATTGTGTGCTTTGATGCACCACTGGACCAACACTTTGCGCAGAAGGAACACGCGCTGGAGCTTTTCCAACTGGAGCCAGAAGCCGTGAGTCTGAA
CCCGATGAATCACTGTGTCCTCGGTCAACACTTGCTGTGCGCTGCCCGTGAGTCAGCGCTTTATTCTCCACAGTCTGGAACGGCTTACATTGACTCGTAC
GTATTCGGGAGACTGTCTGAAAGCCAACACGACGGAGGCCACATGAGCGTTGAAGGCGGTGGACAAACGGTGGTGTCTGAGGTCGACGAGATACTCCAGC
CTCTTGTGAAAGAGCGCAAGTTGATGCAGTGTACAGAGGCTGATGGACGCATCAATTATCGAATTCATTCGTGTATGC