Description :
From Genome Similarity Track
Location :
contig_42:480231- 482062
Transcript NameFunction/comments
g7766.t1hypothetical protein
g7767.t1hypothetical protein

Sequence
1831 bases(100 bases per row)
AGCGCAACCTGAAAAACCCGGAAGCTGGTTTTGCCATGCAAGCGCTGATGGAAATCCCTGGTACGTGTTGCGTTTGCTTCGATGTGGGTTCGATCATGTT
TGACGCAATGTTTACTGCAGAACAATACCAGACAATACGGAACTTGGTCTGCTCGAGCTCCACCGGTAGGCGTGGACAAACACCTTTAACTCTTTTCACT
TGATTGCTGCAACACAAACACTTTTGTCAAAACTTGGTCTTTGTTTATGATACAACAGCAATAGATAAGGTTGGCGATGTGAGCTGTGCCAGAGCTTCAT
CACCCTAACGACTATCAATCTTTCTCCTGGTCTGTTGTTGAGGAATGTCCCTGGGCTGCGTGGAGGTGACAGCCTTCTTGGGGGTACCGCACGACTTCTT
CGAACTCCCCCCCGACGCCAGCTTCTCCTTCCACTCCCCACTTCCAATCTTCGCCTTCCGTTGGGGGATATCCTTGGGTCGTGTTGAGCTGCCTTCTTTT
CGTGGGGTGTCATTCATCCTCTTTGAGGAAGGCGCTTTCGTGGGGTGACAAACTCCTTTGGCTCGGTCCGCTCTTCGCTATCACGCTTCGCTTGCCGTCG
GGGGAAATCAGTGGGTTGCATGGTGCTTACCGTCTTCTTCTTGATGGTCAACCTCTCAGGGCTGCCCTCGTTCGTAGTGGTCGATTTCGCGGTGGTTTTC
TCCTTCTTGTCCTCAGCCGCAAGCTTCGTGGCCTCTTCGAGTCGGGTAGCCCACATCGTGCGATTCCGCTCCACATTGGCGAGGCAGCCTTCTAATCCAG
CCAACATGCCTCCGAGCGCACGCCACAGAGGGAACGCGCACGAGTCGACAAACGCCAAGTTAACACGCGCAAATTCAGCCGATCCGGGCGAGCATCCATG
AAAGCCGTCGCTGAAATCCCCAGCTCAACCTCCTCTGCATGCTGCTCATTGAATTCTTCTAGCAGCCTCGTCGTCCAGCGGAAGTGCTGCTCACAGGACT
GAGTCGGGCCCGAGAGGTCTGCCGAGTGCACAACAGCACTCACTAGCAGTTCACGCAGGGCCTCGTCATCGTTCCGGCTCCCACGGACTTGAGCTTCGTG
TACTTGGCTACAATGCTAGCGTGGCGATGCATATCAGTGGCAAGAATCGCGCGATAATGCGCTTGCGAACCGCACGACGGCTTCCAACAGTGTCACTCGA
GCCATCCTCCAAGCCAGCCAGCACATCATTGCCATGGTCTCGAAGCATGCAGCTGAGTGCATGTTTTCCAGCACGGAGTGATCGTTATAACGACGAGCGA
GGCGCGAGCTGCACCTCACGTGAAAGTCGTTGGTTCTGGCGTCGTGGCCCATGTCGTGACAGAAAGCTGCCACGAACACTGCAAGTCGCTCTCGAGGAGC
AAGTATCAGTTCGCCGCAACGTTTCTGTCGGCTCCGCTCTGTGGCCTGCGCCTTCGTGGTCGGACTCACTCCGAGCGCAGTGGAAGCGGGAATCAGTGAC
GAAGCCAGCTTTTTGCTCTGCGCAGTGAGCATGAGGAACGTCGTGTGCAGCGTGGCGAAGGCATGGTACGTGTTGTGATACGGCACGTCAAGGTACTGGG
CCTGTACGCTGTGCAGGAAGCGGCGTAGCGTGGCTTCCGGCAGTGCGAATCCATCCATGAGGTCGTGCAGCTCGAACATGTCCACTGCGAGGTCAATGAG
CTGAGCCGGCGAGAACTGCCACGGATCCAGGTCCCATTGTAGGGCCGGGCTTTGCGTGCCTTGACTTGATGCAAGGCCAATGCTACCGGGAAGCGAGGCG
AGCATTCCACATCCGCCGCTACTACTCAAGA