Description :
From Genome Similarity Track
Location :
Scaffold_1946:4802- 5968
Transcript NameFunction/comments
Phyta_totarag13909hypothetical protein PHYSODRAFT_321620

Sequence
1166 bases(100 bases per row)
AACAATGTCGCGCTCAGCTCCACTGAGGTCCGGGTCGAAAGAGGCCAAGAACGTGCTCAGGTTGAAGCCAATTTCAGTCCTGGAGGTCATCGGGCGTTTT
GGTTCTGCGGCCTGAGCTGCTTTCGTCGATGCTGGGCCCTTCCTCGCCTTCTTGGATGCTGGAGGGCCGGTGTTCTCCTCGACGCCGGCATTCTAATCCT
TAGCGGCTTCACGAACGTTTTTCCGTGGGCCCGcaccgccgtcgccaacACCAGTCGCACCcttcgccagcttcttcttgtccttgcgGGCTTCTGCTAG
GGCGGCACCAGTCACCGCCTTCGCCGTCGTTCGCTTGCTCGTGCAGAGTGGGGAGGGTCAGACGCGCGCCTCGCGGAGGTTGCCGTCCAGGCCTCTTCCC
CACCCGTTacgtccacgacggcggGAGTGTCGGCAGGAGGATCACTACACGGAGGGGCGGTGCTGGCCCTGGATAAAAGTGAGGTAGGCGCGCTGGTCGG
CTCGTGTGCTCCGCGGGTGATCATATTGGTGTTGGTGGTTAGAAACCCCCTTCTTCACTTGTCGGCTTGTtgtttgctcttcttgaTGCGAAGTGAAGGA
ACGGGTGGCCTGCGGCAAGCAAGCCAGCGCAACCACGCACCGCTATGTACTGATATACCGGTGAGATAAATTCATGTGGAAAACACAATTTCCTTGGTTT
CACCATGGAATACACCATTACAATAGTGTGGCGGAGCGGGATCAAAACAATTCTGTCCTCACACGCACACTTGTTCCCAGACGCCGAGTAACGGAAGGGG
TACTCCAATAAccgtggggggggggggNTGCCTTTTCCTTTCCGTCGTACTTGCCGCTTCCTATAGCGGGATCTTGGGGTGTTTGAGAGCGACGTCGAGC
CTTCCGGCCAAGTAGATAACTCCGACGACTGACACGTGTGTCTTGGGTGAActttgacttgatttttgtatgggCAAATATACTTACCGCTACTAACTAA
CCACTCGTGCTTCCCAAAGCAAATTCGACTCTGATTTATGCTTAACCTTCCCCAAAAACTGATTCCTGCCCTCACATCTCATCCTGAATCCTATCCTCCC
AACGCGCTGATTCCCTCTTCGACTGGCTCTGAGCACCGCAGGTATCTCCAAACTATACTCCCTCAT