Description :
From Genome Similarity Track
Location :
Scaffold_12:480179- 488419
Transcript NameFunction/comments
Phyra_75402protein kinase, putative
Phyra_94146diguanylate phosphodiesterase

Sequence
8240 bases(100 bases per row)
TCGGCGAAAAATTCGGCAAATCCGAGACGAAGCGCCGGCTTCCGTTGCAGCAAAGCCACCAGCAGGTGTCGGCAGGGTCTCGAGAGCTGCAGTGTCGGCG
GGAATCGCAGCGGCTGGCGTTCAATGTTCGCCAGCAACTGCACGTGGTTGGCTCCGCCGTAGGGCGGGCGTCCTGCCAGCATCTCGAAGAGGATCGTGCC
CACGGACCAAAGGTCGGCCTTGGCGTCGTACTTCTGGAACCTTAGAATCTCCGGTGCCATATACAGCGGCGAACCGCACAGGGTCTCGGCCATGGACGTC
GAGGCCAAATGCCTGGCAAAGCCAAAGTCGGCTGTCAAAGCATCCAATAATTGTCAACCCACGGAATACGATAATTGTCAAAAACAAATAATTGCGCGTA
CCGATTTTTAGCGCGGAAGTGGGTGAGTCCTCTACAAGCAGCAGGTTCTGCGGCTTGAGGTCTCTGTGGATGAGGTTGTGCTGCCAGAGACACTGCATGC
CCTTGGCCAGCTCGCGCAGGAAGTGCCTGGCGACGTCCTCGCGCAGCAAGCGGCTCTTGTCGCCGCTCTCCTGCTGGCGACGACGCATAAACTGCTGCAA
GTCTCCGCCGGCGCAGTACTCTAGGATGAGGTACATGTGCTTGTCCGTCTTCTTGATCTCGTAGAGCTTGACTACGTTCGGGTGGTCGATCTGGCGCATG
ATGGCGATCTCCATCTCGAGGTTCTCCAGCAGCTTGCGGTTCAGCTTGTGCAGCGACAGCGCCTTGATGGCCACGGGCGTCTTGCTCGTCTTGTGGTAGC
CCTTGTACACCACGGCGAACGAGCCGCTGCCCAGCTTGCTGGTCACCACGTAGTCGCCGATGGACGCGCGCGACATGGCGCCACTAGGATGCGGGATGCG
GAATGCGGAGACGCCCACGTGGATGCGGAATACGCGGCACAGTGAAGGTCCTCGGGGCGCGTGAGTGCGGAATCGGGAATGCCGACGACGGCGCGGGTTT
CTCAGATCGTGTGGGCCACGCCGGTACCAATCTTTCTGGTTCGGATTCGCCAGGCTTTTGCTGTTGCATATTGGCTGCGGACCATATCAATTGTTTCGAA
AAGGGGGGCGGTGTGGCCCACATGGCGGAGAACGGTGAGTCACCGATGGCGCATTGCGCATCCAGCCAATGGGAGACCGCCATCGGCCACGCGCGACCTT
TGGCCGCGCGACGTCATCGGAGCTTTTTCCTGTGGCGCAAGTCGCAGTTGAGACGTAGGTTGAAGGCGCATGTTGAAGCCGATGGATTGTACAGTGCGTT
TCGGTCGGCTCAGGCGTTTTCGGCGGTTGCTGGGGGATTGTCGAGGGTAACGAGCGACCATGGCGGCGGCGGCGGCCTGGGCAACGCGGTGCGTGCATGT
TGCTCTAGCCTCTCGACGTCAAATCTAGAACTACCAAGCGGCATTTCGCTGGACTACACCATACAAACGTCAAGTGAGCGGGATAGACACGGCGCGATGC
TTCTGAAGATGGTCACATTGAAGTCGGTTTAACAGGCACTCTTCAGGCACCTGTTTCCAGGAGAACCATTCGCGGTGGGACTCCGATACCGTCCGAGTCG
CAGTTGCTCGTGGTTCCCGCAAAGTTGGCCGCCATTCTCGAGAACTTGATGCAGCTGAGCCAAATATTCGCTCTCTCTTGGAGGTGACGGATTCAAAGTT
GGTGATGTGGATGTTCTGGATGGAGATCGTGAAGGGGTTCCTTCGCAGACCTCCGTCTTGGCGTTCGAAGCGTTAGCGGACGCCGCGTCCTCTGACCTGC
CAGTGGGTTTCGGGGCAGTCTCCTGGCCGCCGTGCTCAGCGAGGCATTCGCGGTCGACAGATTAAGTGGTGCTTCCTTCACTGCCGAGGACAATGTTGTC
GCTGGGATAGGCTTCCTAGTTCTTAGTCGCTGAGCGTCATCCGCACAGTAAAAAACGAGATGAACTGCTCTAGCTGAAACCTGCCAGTAGACTGCTGCGA
TGGAATTGTCAAAAATGAGAATTCACCGTCTGAGGGTCTAGTTGAATACGTCATGGCCACTCATGCATGGCTTGTCAATTGTCGACCAATTACACTCCGT
GGCTACTGAAATTGGCATTGAGGCAAACTTCTTCGGCATCAGTAATGTCACCTTATGCACTTATCCGATTTTGTGCACACGCTACCCCAAAACGCATGAT
CTGGCTGGTCCTTCGTCGGACGCTGTAAGTAAGATAAAGGTGTGACCCGGTATAAAACAAGGACTGTTTTCCAATTCTGTGTTCGTTGCCTTTCACTCGA
GCTCGTGAGCGACCTGACATCGAGTCGATGTAGTTATCGCGCCATACAGCAAGAACCTCGCCGTAGTACGACCGTCACACGATGTCGAGGATTTGGTGTC
GCCTTCGACGCTACTGCTGGTGCCCACCAATTTAATGACAACCATTTGACCCGATACTAGGGCCTTGACGTGATCGACCCGGACGCTTCACCCTGGTCTT
GAATCGTGACGGCATCACACGAAGCTGTTCAGGTCAACCACTCAAAATATGCGGCCAAGGATAAAATACAACGTAGTGCTGCTAGAACCGAGTTCGGTGC
ACATTTGGTAGTGTGAACATACTTCGTAATTTAATGTTCGAGAGTTCTGGAGCATCCGCTTGCGAGGAGCCATAGATCTGCTTCGTCTCCTTACTCACGT
CCCAGTGCTGTCCACAAAGAGCCGACCTCACACGTTGAGTCAGCTCGGTCGGAATCTATCTCTAGCACCGGAGAGCCGACAGCGATGGTTGCCTCTGAGT
CATCGAGCTGCATTTCCACGCAAATCCACCGCGTTCATTTCGGGGAACTGCTCCTGGTTCGTTGACACACTAGACCTTAAAGTCTATGAGGGTCTAGGCA
CGTGACCAACAGCTCTAAATTCCAGCCAACACTGATGTGGGGAATGTGCTGCCTGCACGTGCACGTGTGTTATCAATTGCTGTGTGTGTCGTTATGGGTC
TGTCTTATACTTGAGCTCTGGATGTCAATCCTCGCTTCGTCGCATTTTGATGGTTTCCTCGCACGAACTGGCAAGATTTACCAGCGAGAACTCTGGCGTA
TTCGTCCGAGACGAGGACAAATCGCGTCAGCAGAGAAGCTCTCAGCAATTCGTTGCTCCCACTCCAATATCTACCCCGCGAGACATCATCACCACTAAAG
ACATGCCCCACACGCCACCTCTTGACAAGAAACAGTGCAACAATAGCGTCCCGACCAAGGCTGATAGCCCCGCGATTACCCGCCGTCCAAGCTTCACAGC
TCGCGGACTAGAGTTAGTTTTCATGCGGGAACCCTCCACCGATGAAAACCGACCAAAGTCTTGGTCTGGATGCCCAGAGTCTGCACTAGCAGTGACGTCC
GATACTCTGAGTCGCCACGCCAGCACCAATATCATCATCCCGAGCAAGCCCAGCTCCTTGACACGGCCGAGTTCAAGATTCACAAGTACTCGCCCAAGAA
TTCCTGAGGAACATACTGAAGGCGGCGATGACGATGAGAACAGAGACTCGAGCTGGTGGCAACGACAGACGTACTGCGTGAACTGCGGAGGTCTGTTTTT
CATATCGCAGTCCATGTTGAGCTGCACCACCGGCCGATTCTGCTCGTTGGACTGCAAAGCCACCTTCCAGTACGTGGGCCACTTCCAGCAAGTGATGGCG
ATGCGGATGCTGGGAGCAAGCGACGCCACGAGCGCCTCGGCGGATTCAAGTTCGAATGAAAAGGATTACGAAGTTGAGGACGTCGACTTAGTTAGGGAAG
TGCCGTGCCGTGTTGTCATTAACTGTGGAATCAAACCAAGAAACGATAACGAACAAAGCTTGGAATGCTAAATTGAATGAGATGTTGCAAAACTACAGCT
GCTCTTTCACCACCCACGCAGTGTTGCCAAACGAGTGGCGCTACTCACAGCTCTTGAACTCCATTTGATCGTGACGCAAGAGTAAAGCGGGGTGCGATGC
TCAGTTCTGGTTGGGGGTTAGCCACACAATCCATGGGCTGAATACGGACAGCATATCGGACACCGAAGATACAAACTGGAACTGAATTGCAGACGAACTG
GTTTGGGACTCGATAGTTGGAGCCGATTCGGTCGTAAGCCCGTCATAAATGACAGTGTAAGTCCCCAAGTTGAGATCCGCTGTAACCTGTGTCCTCACCC
CCGAGGAAGTGTAGCCGCCAAAGACTTGATTGTCCATGAAAGCGACCAGCTCGGCGGCGATGCCATTGTCGGTGTAGTATAGAGTGGTACCCGTCGGCGT
ATCAACCTTTGTTTGTTGTCCAATGTTGATGGGGAAGACGCTCATAGCTCGTGTGATCTCCAGATTCGCGGTCACGCCTGGGCTATCCGTGTCGACCAAC
TGCTGAACACAAGATGCCCCTTCTTGACCTGTTGTCGACGTGATCCACTTGGTTGCACTGCACGTTAGCAACTGAAGCAGCTTCTGCTTGGCTCCCAGAG
ATGGTATTTCGTAAAAGGCACCTAGCACCTTTGTTGACATATCCGAATACCAGCCCGCGGTGCCTTCCATAGAGCTCATGTACTTGAGGTTGGGGATCAA
TCGGTTGCTTACAGCAGACTGACACTCTGTGTCGTCAAAACAATCTTGCCGCAGACCTTCACACTTGGTGCACTCATCTCCGGTCGACGACGAAGTACCA
GACGACGAAGTATCAGACGACGAAGTACCTGGCGACGGAGTTTCGTCAGACACTGCCCCATACTCCAGCAAATCGAGAAGTCTGTCGAACGGCGGATAGC
GGCCAACAGACTGGAGCGTCACCTTCCAGGGCGTGACAACTGCTTCAGCAGGCGGGTCAGCAGACACATCGTCTGTGGTAATGCTGAATGTAGGTATCCA
ATTGGGGTTTACAAGAGGCTGGTTGTTGCTGGCTTCGTCATACATTTCGTACAGCTTCATGCGCAGTATAGTGGCTCCCGACAATGCGTCAGTTTCTTGG
AACCAGGGCTCAACAACCACGTAAAACGGCTCCGAGTTCGCAATTGGTGTAAACCAGCGTATGAAGTCATTTGTGGTATCCGACCCCTGGCCCGTTGTCG
GTGGCGAGTACGAGTAGCGGTTTCCGTCGAACCACACATCGAGTTTTGTGTTCGCGTAAAGGCGGACGCTTACCTCGACGGGTTCTGAATCAATATGAAC
TTGTGTGGGCTCCAGATACGTGCCGTTCGAAGTCGATTGCCCAAAGCCCACCTCGCAAGCACACAAAGATAATGCATAAATCAAGTGAGAGAAAGCGTGC
CAACCCTCTTGGGACTGGAACGCCTCGTCCTTGAGCGACAAGAGCGTCGGAGTCAAGGTGATATTCACAAGGGTCTGTCCGTCATCGTCTGTACCCGTCC
ATAATGGAAACGTCGCGCTGCGCAACCGCGGAATTAACACCTCTCGCGCCGAAATAGTGCAGTCCATATTGTTTTGACATCGTGTCACGGCCTCCCAACA
TTCCGGGCAGCCGTGGCACACAGGAGTTCCGCTAAAAATGTCGCCCGAGTACGAAAATATGTTGGTGCTACCCGAGTACAGATTAGTCCAGTAATAGAGC
AGTTCCGCAGAGACGGTTTGGCCATACTGGACTAGGTTGGAGCTTAGCTGGAAAGACATCAACACTGTTGGGGCTTGAGGTTCAAACGGAGATCCATCCT
CAGTCAAGAAGAACGTTGGAATCACCGCTACAGCCGGGTAGTAAGTGATGTCATAGCGTACCCAGTCGCCACCCGTCGATGCCTCAATCTCCACCTTGGA
TTCATAATTCGTGGTCGCATACAGCCAATTCTCGAGACCACTCGTCGCCGGAGCTTGAGGTTCAAATTCAAACGAGTAGCCCTCCACGTTTGCTGAAACT
TTCTTACCCAAAGGTAATTTCAGCACAAAATGACTGACGAGTTTCGTGGTAACTGGCACCAGTGGTGCCGCGGGATCGGGAGACATAGCGTACCCAACTG
GGCAGGACTCTCTGTCCAAGCACGAAAAAAACTGTAACACCTTGGCGTACACGTGAGGATCGGCGGACTCCCGCCAAGCAGCAAATTGTGCAGAAACGTC
AATTGACGATCTCGTGTTGTAATGATGCAGATCATTCCAAAGCGGCGCTAGAATACCCTGGCGCATCTCGTAAGCACAGGAATCATCCGAGAAACATTGC
GTCCAGCTGTCCATGCACTGGTGGCAAATGGGAATGTCTTCGGCGGTTAAGTTGCCACTGCCATAGTTTCGATCCCAGCCTAACTCATACAGCCAATTCA
TAAGTTTTCGCCAGGTTACTACAGGATAACCATCCGACAACGTCTCATCGACATCGTTGCGATATGCAGTGATCAACGCCTTCCAGTGACTCGACTCGAT
CTCGTCGTACGTGTCATTCGAAACGGGCCTGAGGCGTGGCATCTCGGCTTCGGTAAAATAGTCGTTCCCAAACTCTACGCCAAGCACACGATAGCCAGCC
ACGTAATAGCGACTCATTTCTTCCACCTTAAGCGAGGAATTCTGAGAAAGACTTCGGGTCCACAAGCTCTCGTCAGCGTTGTACTCATTCATCACGTCTG
CAATAAAAGATTGCAGGGCGTCGAAATAGTTTGTCATCTTATCCCACTCAAACAGAGACTCTTTGCCACGATACTTCATGACAATGTTCTCACCGCCATC
CATCCTACTTGGCACAGCAAATACACTTCGTGCGGGCTCAATCTCCAAGCGCGTTGGCTGCGCGGAAACGTATTCCCCACTGGAATAGCTGTATGCTTGG
CGTGGCAGGTCCAAGTTGCAAGCGTAGTTAAATACACACACCATGAGATTCACAAAGAGTTCGTAGCCTTCTACAGTGAAGAATGACGCAGACTGTCGTA
ATCTGGGTGCGATGTCCACGTCCCACTGTCGCCTGTCGTTAATTTGCACCTTACTCAAGCTTTCGTTGACACCAAAGCGACTCGGAGACAGAGCCTCCTG
TAGGAAAGAACGGACTCCAATACTGCAGGAGGTGCTGTTATCGCACGCGTTATACGCGTCGGTACAGTCGGTGCAAATACTCCAAAAGCCATCGCCCCAG
TCTGAGGCATTCCGGTATGGGTCAGGATACTCTGGAATGTCTTCGTTCCACGTCAAATTAACGTACGACGGAGGTGGCACGTACTCGAACGTGCTCAAAT
TTAGCGGGGACAGTTGAAAGCGAAGCTCACTGCCTCGAGCGTCCCAAGACATATTTGCCGGCGTGCTGCCCATCGACTCGTCACTGACCATATACACGTC
TAGGATGTTTGGCACGACACTCACGTTCCGGAGGGAGATCTCCACGGTGAATTGTGGCTCTGGTACAGGGATCATATGGGTGAACGACCAGTCAGATCCA
TCACTGCCTTCGCCAACATTTGGAGAGGAGCCATCCAAACTCGCACTGTTGGACTCAGCGTTCGGGTAGAAGCCATTCATCGAATCTTCACCTGCAGGCG
GGAACTGGAGGGAGCTGCCAGCCGAAGCGGAGGCAGAGTAAGACGACCACGCGGCCGACGCCTCGGATGCTGATCCACCCGAGTTGTGATAGTCCTTCAT
CCACTCGTTAAACGTGTTCACCCAGTCGATTACGTCTGAATTGTTGAAGATGCGAACATCAACGGCTAGGTTGTAGTCACTTGCGTTGGGCACAGCGCCT
GCCACCAAGTCAGCTATCTCCTCGGGGGAATGGTCGCTCGACAGCTCAGGGGTTGTAAACTGCCCCTCCGACCCGAGGCCCTCCAGCTCCATCCACATGT
AAAACCGGTAGCTCGGGTCTGTGAAATTCACGCGAACTAAAGCGTGTTCATGCTCCAAAACCACCATTCGCCCAGCGGCCTCTGCGAAATTGCGGTTGCC
AACAGGGCACCGAGACTCGACGAAGCATTGGATGCCACTGTCCGTCTCGCGAGCGATAGACAACGCCGCAAACAAGTCCCTGACGGAAGGCCAGTCTCCA
GCATTTGGGTCACCTGCTGATCCAGCCGACGACCAGCGTGAACCCGCATCGGCATACTTGGAGGCTGACCCTGTATCTCTGTACCCCCACGACGACCAAC
GAGACCCCGAGTCATCGTATCGGTAGACTGGTTCGCGGAAACTAGAGCCATCGTTGTACTTGTTGTAGTCTCCATTAGATCCCGACCCGGGCTCACTTCC
TCTGTAGCCTGCATCGCCAAAGCCAGAGCGTACATCGCCA