Description :
From Genome Similarity Track
Location :
Scaffold_34:480099- 481356
Sequence
1257 bases(100 bases per row)
ATTACCGGTGTTGGCGCAGAAGGCTTGTCGGCAACCGGTATGGTGGGTTCGATACCGGAGTTGTCACAAAGTGGTTGTCGCCTCTTTCACCCCCACCCAG
AGTGGAGCCACACGGCGCCGTGGGACGGCCCACGGCGAGGAGAGCTGGAACGCGAGGGTGCCGAGCGTTGTTGACGAAGAAAGGAGTCAAGCCAGTCGAC
GCGTGAACCGCGTTGTTCAGCGCGAACTCAGCAAGCGGAAGGAACGAGCTCTAGCTTGTAAACGACGTCGCATAGCTGCGAAGTACGTCCTCAAGGACGC
GATTAACTCGCTCGGTTTGGCCATCCGTCTCCGGATGAGCGGCCGTCGACATCAGCAGCTTTGTCCCTGATAGCTCGAAGAGCTTCGTCCAGAAAGCAGA
CGTGAACCTCGGATCGCGGTCCGAAACAATGGACTCGGGCATGCCATGATGACGGAAGACTGCATCCACGAAGTGCACCGCGGTATCGGCCACGGTGATC
GTATCCGGGACCGGGATGAGGTGAACCATCTTGCTGAACCTGTCGATGAATACCAGGACACCGGAGCGCCCGGCGGAGTCGGGTGGGAGACCAAAGACGA
AGTCCATCGACACCGAGCGCCATGCCTCGGTGGCCACTGGCAAGGGACGCAGGGGAGCCTGCGATGACGCGGACGGTTTCACGCGTTGGCAGATCTCGCA
GGTCCTCACCCACTTGCGCACCCACTTATACATGTGGGGCCAGTAAAAGTCGCGCGACACTGCGGCGAATTTCTTCTCACGGCCCAAGTGAGCGCCAAGG
GGGATATCGTGGGACTCGTGGATGATCCGCGAGCGCAAGTCAGGGTCGTTGGGAACCACTACACGCGAAGCATCGAAGCGATCGAGGCTGTACGTTAACA
GCCCGTCTTCAATCCGATACCTATCGATCTGATGGCGTGTGGAGCGGGACAAAGCACTCAGTGTCTTTTCACTGGGCGAGCGGAGATGTTCCAGAATACT
CGAATAGACCGGATCGAATTCATACGCAGTCCGGATTTCGTCGCGGAGTCTTCGAATGCATTGAAATTATTATTTTGTTGGTCGGTAGGGCAATGATGAG
CAAGCTGACACGTTTCGCACGCTGAAAGCAAGTGCTACAATGCGTACTGAAATTTTTTGAGCATCTGAAATCACCACAAATATAATGGCCCTGATAATAA
AGAAGTATTAAATTGGGATCGTTTTTTTGTCAGCTTTTATAAAGGTCTGATTTTTGA