Description :
From Genome Similarity Track
Location :
contig_15:480027- 481205
Transcript NameFunction/comments
g4072.t1RAW36293.1 hypothetical protein PC110_g7420 [Phytophthora cactorum

Sequence
1178 bases(100 bases per row)
ATCAAATCTCAGGTAAACGTTCCGTTGCGAGTCGCGACTTCATTTGTGGCGAAATGCTCACAACTTATCTCGTCGTGTTTCACTGGATTAGAATTCTGGT
TGTGGACGAAGCGCATATGTATCGAGGCGTATTTGGATCACATGTAGCGTGCGTATTCCGCCGATTATTTCGCCTATGTGCGCTTTATGGGTCCAACCCG
CAGGTGGTCTGTTGCTCGGCCACGATCCGAAACCCGGAAGCACACTTCCGACAACTACTGCCGTCGCTTCCGCCTCAGCCCGTAGTTGCGCCTGCGAGTG
CTCCTACTGATGACAATCCCCAAGAACGATCAGAGGAAGAATTGGGCCCACCCAACCTGCATTTTTTTCGCCAGCGCCCACTTCAGGTTATCACAAAGGA
CGGAGCTCCGTCTGTAGAAAAACTATTCTGTGTCTGGAACCCAAAGGTATCTAAGAAGAAGAACGTGAAGCAAGTGGAGACCGAGCGTGATGAACCCAAT
CCATCACAACTTTCTTCATCTGCGTTGGCGTCAAGAAAACGCAAGCGTACCGAGGGCACACCGAACATATCGAAGTCCAATGATGAAGATCAATCCAGCA
CGAGCACCAGTGCGATTTTTCAAGGAGCTAGAATCCTTGGTCGCTTAGTGGAAGCTGAAATCGCTACACTCCTGTTCTGCCGGGGGAGAAAACTAACGGA
GCTGGTATTGATGAATCTCCACTCGATTCTGAAGGCCGATGCTAGCACTCAGAATCTGATTCATCGGGTTTGTTCCTATCGTGGTGGGTATACTCTGGAA
TCCAGGCGGCGGATTGAGCAGCGACTGTTTAGTGGAGATTTGCTGGGTGTTGTGGCAACGAACGCTTTGGAGTTGGGTATTGATATCGGCGAGTTGGACT
GTACTATACATCTTGGACTCCCATCGAGCGTCGCGTCCTTGTGGCAACAAGCCGGTCGTGCAGGTCGCCGCCAGCAGCAATCTAAGCAAAAGCAGTCTGT
AGCGATCATTGTGTGCTTTGATGCACCACTGGACCAACACTTTGCGCAGAAGGAACACGCGCTGGAGCTTTTCCAACTGGAGCCAGAAGCCGTGAGTCTG
AACCCGATGAATCACTGTGTCCTCGGTCAACACTTGCTGTGCGCTGCCCGTGAGTCAGCGCTTTATTCTCCACAGTCT