Description :
From Genome Similarity Track
Location :
Scaffold_702:4800- 8538
Transcript NameFunction/comments
Phymu_g11625hypothetical protein

Sequence
3738 bases(100 bases per row)
GGTTGACTTATTTGTAAGGGCGCTCGCTGGGCCAAGGACTGCCCTGACGCGACCGATGCGCAGAAGGATGATATAAAGCGTGGACTacaggcgaagaaga
cgcgccAAGAGGAGCATGTCAAGGACGTGAGGAGCATGCgggctgctgaagaacgccGAGTTCGTATCAATGGCATACTTGACGTACCGTTCTGTGCGGA
CACTGGTACGGATAGTAACATCATATCTCGTGCGATAGTGGATGAACTACTTGCTGTCGGTGATgtagtgctgcagcggctAAGCCCGCCGGTTCATGTG
CAAGTTGCCGGCGGTGCAAGGGTGTTATGCCGAGACTCGGCGACGCTGGATTTACAGATcgaaactgcagcaggaccGCTGCACCTCTCCAATGTACCTT
GTTTGGTGATGGATGGAAACGAGTAAGAGTTCTTGCTCGGTCGCAAGACAATGCAGGACATCGGTATTGACATTGACCGATTGTTCGAACGACTGGCTGG
TGGAAGCCAGGTTAGTGACGCTGGTGAAGAGGACGTCACCGGTGAGACGCCTGAGCTGGTATTTACGGTGGATAATGAGCAAATCAAAGGACATTTGAAT
AGGATGCTCGGCGAAGCCAAGAACGCTGGGTTTGACCCAGCACTATTAGGCAGGCTGCGGGATCTTGTATTCGAGCTTGCCGATGTGTGGCGTACCAGCA
TTGGTGCTGATCCTCCGGCAGACGTGGAGTcgctgaaggtgaagctgcgCGACGACGCACAGTCATACCGCAGCGGGACCCAGAAGTACCATGAGTTGCA
GCGCAGGTTCCTCAGGGATTTGTACGTGAACTGGAGAAAAATGGGCTTGTCCGTCGCAAAACCCCAAGCCACTGGgcttgtccagcacttccagtcaAGA
AACCCAGTACTGATGAATATCGCTGCATGACAGACTATCGCCCCATCAACACATACACCGTGCCTTTAGCAGGAGCTACCCCGAATCTGTCGACAGCTAC
GCAAAGTGTCAAAGGAGGTTATGGTTTTGGTTTGTTTGATCTTTTCAAGGGCTTTTGACAGTTGCCTTTAGACCCTGCAAGCCAAGAACTGTTCAGCTTT
GTCACTGAGGACGGCGTGTTCACCCCGACGAGGGTCCCACAAGGGGCAAGTGATTCAGCTATGCACTTCCAACTGCAAATGCAGATATGCTTCCGAGACA
TGCTCTACGCCAACCTCCTTGTCTGGATCAACGACTTACTCCTGTTCGCGATGACTGCGGAGGAGTACATTGCCAACCTCCATAAGTTTTTCCTCGTGCT
GCGGGCACGTCGCCTCAAGTTAAACGCGAAGAAGTGCGTTCTCTTTCAGAAATCGGTGGTGTGGTGCGGAAAAGTTATCAACGGCGCTGGTGTTAAGCAC
TCGCCGGACAGCTTGCAAGCATTGGCTGCCTTGAAACTACCTCCTACAGCGGCCGCACTGCAACAATTCCTCTGTGCAGCCAATTGGCTGTATGATTCTA
TGGTTGACTACGCACGCGTTGTAACGCTGCTCCAGGCAAAGCTGGAAGGTGTAATGGCACGTCGCGGTCGGCGTAAGTCAGAGCTCGCTGGTGTGGACTT
AGACTGGCCGCAAGAGGACCAAGATGCTTTTGGAGTGGTTGTGCGGCTTCTTACAACATCAGCGAAGCAGTTCTTTCCTGATTCCAGCGCGAAGTTGTGC
ATGTTTAGCGATGCATCGCTCACTGAATGGTCTGTCGTGTTGAGTCAAGTTCATGATTGGGTGGAAGGTGTACCTGTTGCGGATCAGCCACATGAGTTGC
TCGTGTGTCGAGGGGGGCTTTTCACAGGTTCTCAGGCGAATTGGTCCATTGTGGAGAAGGAAACCTACCCTGTTGTCCGTGCTTGCAGCGACTTGGCTTA
CCTGCTTGAGAGGGAGACAGGAGTCCACATTTCCTGCGACCATACCAATTTGATCCATATCTCCGCCCCTGATAAGACGATTAAAGTGCATCTGCGCGGC
AAGCTACAACGTTGGGTACTACAGTGGCTGTACGCTATACAATTGAGCATATCAAGGGCGAGAGCAACGTGTGGGGCGACTTAGTCTCGAGATGGGGCCA
AAGCAGCGGTTGTGCGTCGGACTTTAATGTGGCCGTGAAGCGAGTAGCTGATAGTGTCAGCCGTAAGGGCGGTGTTGAGGAGCAGCCAGAAGCGAGTGGC
ATGTCAGTGGAATCCTCGCCCACCACATTCACCACGATGAATCTGTCGGAGGGGTATTTGCAGTTGCCAATGCAGGAAGGGTCGAGGCAGCATTTGGAGA
CAGCGAAACGAGTGGCCACCCGCGGCATGAACACCATCTCGACGCTGCGACCTTTGCAGGACGAGGGCTTTGTCTGGCCAACGCCAGATGCGATTGGAAC
TCAGCAGCGCCTGGAGCATGCAGACGCTCCGTGTGCCGCCGACGAAGACGGTTTCATTCGGGTCGAGGGCAAATTGTGGGTTCCTCGGCAGTACTGCAGC
GGCTTCTCATCGTGGCGCATTGCGGGCCTCAAGGCATCGTGGTAGCGACGTCACGATCGCTGCCCTTAGTGAACGGTTTTCGATCAGCAATTTGAAACAG
CTTGTTGCTCGGTTTCTCCGTGACTGTTTGCTGCGCAAGCACGTAAAAGATGGTAAGATCGTGGTGCGCCCGTGGGGTCCTACCTCTACTACAACGAAGC
GCAACGAGTGCATCCATCCCGACTACTTGTTCCTTGGGAATTTCTACGGGAAATGCCAGTACGTTTTGGTGCTCAAAGATAAGCTCACTCACTACTGCGA
ACTCATTGCTGCCGAATTCTCGACCAGTGCTactgcagttgaagctgtgCTAGATTGGCACAAACGTTTTGGCCTGCCTGAAACATGGATGTCCGACAAC
GGATCTCATTTTAAGGCTGCCGTAATGGCTGAATTAGCGGATCGTTTAAGGGTTACGCACAAGTTCGTGCCGGTTTACACACCGTGGATTAATGGCACGG
TTGAAAGGGTGAATCGCGACATCCTAcaagtgctgcgtgtgctACTTCTCGAGCTTAATCTAGACGCGCGCAATTGGGTCTACCTCCTACCGGTGGTTTA
GGGGAACCTTAATCATTCTCCAGTAGCATCTCTTGGTGGTCGCGCACCCGTGGACCATTTTACGGGACTTCCAGCCCCGTCGCTACTCGACACTGTGATT
GTACCTGTGGGCGATTCTGCTCGGCTGCGAACCGTAGATTTGTCGGCTGTCGCGCCACATTTGGGCGCTCTGCGTGCTCACATGGACGAGCTTCATCGCG
AAGTTGTCCGCCGCAAAGAGCAGCGTCGCGCCTACGAGATCGGACGAGCGAACGGCAAGGGTTGTGACTTCACCGAGGGTGATTACGTGCTGTGGTCACG
TGTTGATGCCAGGCTGCGCGGCGCCAAGCTGCAAGTGCGTTGGGTGTGTTCCTTTCGTGTAGTCCGTGCACGCACACACTCGTTTCTAGTGTCCCATCTG
CTCACTGGAGACGAGTATGAGGTGCATGGCTCTCGTCTAAAGCACTACTGTGATGGCATTGGCCGAGATTCGCCAGCATGTGGCTACGCAAGGCATCGTG
CTGGGCGTTCGGGCCATTGTTGACCACCGCTACGACCCTGCTGCCAAGAAGTTTCAGCTCCAAGTGGTGTGGCGTGGTCTCCAGGATGCAGAGAACTCGT
GGGAGCCTTTCGCGGCGATGCACCACGATGCTCCGGTC