Description :
From Genome Similarity Track
Location :
Scaffold_674:480- 5564
Sequence
5084 bases(100 bases per row)
TGAGCCTGTTGCATGTAATTAACCCTTGATACTTGTTAATTAGAATATTATTAGAAAAGTAGATAATGTTCGTGAATATCACCACAAGGGGTACTATTCA
GAAACACTCAAACTGAAGTCTTGCTTACCACTATCGTGACGCAGATCAAGATGAAGCCTGACTGCGACTGAATTGATGCTCTGCTCAACGGCGGCTTTCA
GTCGAGTTTACTGACCGAAGTCTGTGGCTAATCTGGAGCTGGGAAGAAGCATATGTGTCTACAGCTGTTACTTCCATGCTGTCCGCCAATCTCCCTCGGG
GTGCTGCCAGGCACAACTAGTTAATTTGCACTGGCAACGTCATGTAAATCAGCGACTGCACGATCTGGCGCACGTCTCTGCACGGAGACATGACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGACGCGTTGCCAGCTGAAGTGATCCTGCTACATCAGCATGG
TCACCAGCAGACTGAGCTCCTGATACAGCAACAGCCTCAGTCTGCTACTGCAGCGTAGACACGTGAGCGTCGACGCGAGGCTCTAAAGTTAGAAGTCTCC
AAGTACCAGGGAGTCGAGGAAGACTCCCTGTTGAGATGGTTCCTCGACGTGGACGATGCCATTAAAGCTCGTCACATCGACGATGAGGAAATGCAAGTTG
CATTTGCCAAATCGAATTTGTAAGGCCTACCAGAACTTGGGCCTAGAATCTTCAATTACACGAACCAAACGTATTTGGATCGTCGGCGGTTGTTAAGACT
CTGCTCAGACAAACGTTTGAGCCGCCAATAGCTGAGTTCAGGACTCTTTCAGAGCTCCTGAAGATAAAACAAGATAAGCGTGACGTTCACGCTTACGCTC
AGCACGTTAGTTACCTTGCAAGTTGCATGGTAGCGAACCCCGTAAGTGAATTCGAGCTGATCACGATATTCTTACAGGGCCTTATAGATGGTCTCGTGAG
AAACCACCTATTTCGCACCGAATTGAAGTCGCTTGAAGAAGCGATCACAACTGCGGTGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACC
CCTTATAGTCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTTCAGTGTTGAGAGCGAGAGACCTCACTATTCAAGCAGTAAGCGAT
TGCAAAAGTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTACTGCTTCACGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCCACCGAC
TGCCAAGAAGGGCAACGGACGTGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTGGCGGACCATAAAAAACGTTCGGGGTCAGTAGGAGCGGAGCACCT
CAATAAAATTCGCAAACCTTTTGATGAAAGTTGCTCTCGACTCACAATCCATGTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATCACCTTGAATTT
AGAAGTGACAAAAGATTTCTCAATTCGTGCTTTAGTTGACTGTGGGCAGTCGAACAACTTTGTTTGTCGCCAGTCGCTAGAGGATCGTAGGCTCAAGTTC
GTTCAGCGCGTTACTCCCCCTACGAGGCTGAAGGTGCGCCTCGCAACAGGTGCATCGATAGCAGTGATGAAACGTGTAGTGGGATTTTACTACACATTAG
AAGATTTGCAGTACAATGATGGTTTCATCGTACAAGAATTGAATGACAAATTTGATGTCATCCTAGGGTTACCCTGGATCAGAAGATACGAGCCAAGGGA
CAGCTGACTGCATCAAACCGCGAAGATGCCTGCCACTTTTTCATCAGATGGCTATCTGATGAACGTCTTGGAGCGTCCACACGCGTGTGGATGTATTGCG
AGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATCACAGTGTGACTACCAATCACACTGTGGAGGAAGCTGCCGGCGGCT
GTGCGGATGCAGGCAACGCCGAAGGTCCACCACTCGAACAAGTCGAGTGTATCGGGACGTGGGTGTACGCCTAGAGGGCTAAATCCAAGAAAGAATAAAC
AGGTTGCCCGCAAAGGGCAACACGATGATCCTAGATCGGCTGGAGAGTCGATCGTAGAGGACCTAGCTATGGTAGCGCAACCACAGCTAGAAGACGTCGA
GGGAATAAGTCCCCACGTACTTGAGAAAGGAATTCCTCAAGCAGTTATTGATGAGGTAACGAGACCTCATCAGTCTGAGGGAATAAGTCCCCGGCAGCCT
ATAGAAAAGGATTCCCAGGAAGAAACCGAGAGATTGCATGTCTTGGTTTATGACGGGTCAAGTGTAGGCGCTTATACACTTGATCTGATCGCGTCACCGA
AGTTAACTTCGGAGATCACTCAATTGCCAACGCTAGAACCGAGACGGTTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCATATTTGTGTACTCGTCAC
AGAGGACGAGTATGCGACTGCCATTCGGTCGGCAGTAGTATTTGCCGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGACGAAAGTTTCCTAAATGAG
AAGACTCGGATTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGTAAATTCTTTATATAAGGATTTGAATGAATTCAAGGACGTGTTCCCTGAAT
CCGTACCATGTGAATTGCTCAAGGATAAAGACACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGCGTCATGAAGCAGTGGCCACTGCCTCG
TGAGCAAGTCCTTGTGATCGACAAGTTCTTTGCCGTTCGCTTAGCTTCGGGTCATGTGAGGGAGTCAACTTCCCCTCACAGCTCTCCGCCCTTCTGTGTG
CACAAGGTCACAGGAGGATGGCGGATAGTGCACGTATTCAACAAGTTGAATGATGCAACGGTACCGGCTCGGACGCCGATACTGAGGAAGGAAGTAATCA
TTGATGTTATGTCAAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCAGATCCTAATGCGTGAACGAGACATCCCGTACACGGCAGT
AAGCACACCCCAAGCGGTATGCTCTGGGAGTGGCTAGTAATGACACAAGGGCTTAGCAACGACCCTGCCACATTCAACAGATGTTTTACAAATCTGTTGA
GACCGGTGCGAGAATTCGCAACGAGTTACTTTGACGATGTATTCGTCCATAGCCTGGCTATGGGCGGAAAGACGGACGTAGAGGTTCATAGGACTCACGT
TCGTCAGGTTCTTACACTTATGCGCAATCATAAGCTGTACGCCAATCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTA
GGTAAACACGGCGTACGCCCTGATCCGTAAAGGATCAAGGCGATTACCGACTGGCCTGTGCCAGTCGACGTCAAGAGACTAAGAAAGCTCCTTGGTCTAG
CGGCGTACTTACACAAGTACTCGCGCAACTACGCCGAGATGACCGTCCACCTCTCTCGTCTTTTGAAAAAGAACGAGAAGTGGTCATGGGACGCTGATTG
TCAGCATTCCTTTGAAGGTATCAAGCAGATCTTGGTGCAATCGACCATCTTGGCGGTTGCAGACCAAGACAACCATTAAATGTGGTCTGTGACGTCAGTG
ATTTAGCAATCGGCTGCGCGTTAATGAAGTACGATGCAGACGGCGCAGAGCGTGTCGTCTATTATCAATCGCGTCAGCTGCAAGCAGCTGAGCGAAATTA
TCCAGTGCATGACAAGGAACCCCTTGCCATAAAGTATGCACTGGCGAAGTTTCGCGTCTATCTCCTGGGAGATAGGCCATTTGTAGTCTATACGGACCAT
GCGTCATTACACACGGCCGTAAACAGCACACAACTCTCGCAAAGGATGGCGAGGTGGCTGTTCTTCTTTGCGGATTACAACTTCTCCGTGGCTTACAAAC
CCGGATGAATTCATGTCGTCGCGGACGCGTTGTCGCGCCGACCCGATTTCGAGTCGGCTGCGCAGTCCAATAGTAGGGTTGATGCCACTGTTGCAACACT
AGTCTCAAGTGTTACGTCATCGACATTGCTTGACGACATCCAAAAGGCCTATGCAGAAGGTAAGGATCTTCTGCGACTAATGGATCACCTGGTGACTCCA
TCTCGTAAATCTCTCAAAGATTTACCGGCCTTGTATCGATCTCCCACGGATCGATACACAAAACGCAACGGGTTGCTGTATTATACAGCCGTTGCCGGCG
ACACAACTCATGTCTTCGTCCCCACTCATGATGATTTGCGCTTGCGCATCTTGTATGAGTGCCACGATGCACCAACTAGTGGGC