Description :
From Genome Similarity Track
Location :
Scaffold_1021:480- 3187
Transcript NameFunction/comments
Phyke_g11435conserved hypothetical protein
Phyke_g11436hypothetical protein

Sequence
2707 bases(100 bases per row)
CAAGCTGGCATCCATTTGAGTCTCCCCTGTATTGTAGTGCACTTCTGCCTCTGCTCTATTCCTCGGCGCtggcctcctgctcctgcttcttcgcgTTCTC
ACGcgcgagcttcttggtctggTGACGGTTAAGCGGCTTCTTGGACGGGTCGAACTCACGCAGAATCACTGTCAGGTGCGTGTGCGGGTGGTGCATCACA
CCCGAACGACCTGcatagcagcaacatcatACAAAACAATATTCACCAAAACTGTGTCAATAACCTTCACTTCACCCCACAACTACATCATCACTAGCTG
CAGTGTCCTCACCTCTGCCCATGATCCGCAGACGCTTGAGGAACACTCCCTTGTTGACGAAGCACTCCGACACCATGAGGTTCTCCGGTTCAATCTGGTA
CTTAATGTCCGCCAAATTGATGGCAttctccagcgtcttcttgaaGTATTCGGCCGTGCGCTTGGGCGAAaacttcatctgcagcacagCCTCGTTGGCT
GACAGTCCGCGGATCTGCTGAGCCAAGTAGGTGAGCTTGCGAGGGCTGGCACGGATCGATCTCTTGACGGTCTTGACCGTGCGAGGCTCAGAGGGCGATG
TTGAGTCCAGGAAAGCGGCGGTGGCGTCGTCCGCAGCGGCTTCAGTCTCTGTCGTGGTCGTAGACAGCGTTGCTCTAGCCACACGACCCACCAAAGAACT
CCCAGCGGCGGGGCGTAGCGTCAGCGCGCCCATCTGCGAGCGAAGAGCTGCCAGCATCGTGATCGATCGTAGGAATACTGGGAAGGGCTTTTGCTGCCAC
ACATCCGCTCAAACCCTGTAAAATATGATACCGCTATAAAGGGGGTAAATAAGTACCTTCTTACAGTGATACAATGCAAATGCCAAAGTCAACAAGAGTT
GAGtttcattttttttaaagcTCTACAGAGGTGGAGTGTCAATACTCGGCTGTCTAACTACTTGGCTGTATGATACTCTTGTACTATGAGTGATTTCAGA
AGTACGGCATTCCATGACTGGAATTCATATGCGACTCCAGGGTCGTGATCCCACCAGCGCTGCTTTCTTCTGATTGCTCAAAACGTCGACACCTTCAACT
TACGCTCCTCGTCCCCACCTCACCACATGGAAATGTCTGGCCTTGTGGCTCATCACGCGAatggcgacgtggtgcgCGTCTTCTTATCTGAAATCCAGAT
GCGCAGCTTCTCTAAGTTCTCAGCaacgtcatcatctccatcttcgtcgtcactggcAATAGCTCCGGCACTCATACGATCGACGCTTGGACGCCCAGCG
GCGTTGACGTGGTCCGCATCATCGGGCAGCCACTCGATATTAACTTCAATATCCGTTCGGTTAGATACCAGTGGCATGAGGTACGACACGAACCGCTGTC
GCGCCACGGCCGGAAGCGACGGAATCTCAATACCTCGCACTGTGAtctttgctgcagatgtgcCTACAACAATGTCGGCAATCCATCCACCTAGATACTC
GAACTTGTCAGGTCGTCCCTTGCAAATATCTCGACGCAAAGACAGGAGGAACTCAGGTGTGAACTGCTTGCACTTCTTCTGTAGTTTGTACTGCACGATA
GCCTCGCTCAGCGCCTGTATCTGCTCAGTGTTTTCCATACCGTGAGTGCCTAGGTCGTAGCATTCATTGCACAGATTGTAGTTCGAGCACACGCTGCAGG
TCCAAAGAGCACCCACGACAGGGTCCATTCCACAACCATCACAGAACGAGTCCACGTGTACCAGTGTTTTCTTGCGCTTCCACTTCGAGCCGATGATAGA
TGCCCCCTGAGTCATAGCCGCTCCAAGTCGCCCCATTATCGGCTTTGCTAACGAGTATTTCCTATCGGGCAGACTCTTCGACTGCGCGCCATCCTTGTCA
TGTACATCACGTTGGAACACGAGAGTACGCGGGATCGTAGATGTTTGAATGATCTCGAACACCTGCTCCTTAGTCATGTGCGCCTCGATGAGCTGCCCAT
TCACGCTAATCAGGTAATCGCCTACCACCACGCCAGCGCGCTGCGCCGGGCTGTCCTTATCGACACTCCACACCTCTACAAGGAGCTCGTTCTCTAGAGA
CACCACGACATTTGTGTTGAAGCCCAGAACTGGCTCAGTGAATGTCAAGCTATACGTATTGAGCGGGTGCTCCATGTAATCCGCCTCGGACTGCGAGCGC
AGCCCGTGCTTGGGGTCTGCAGACTGCATTCCACTTGCACTCGACGACGTGCGGCCAGACTCACCACTCCCTGTACTCGTCATACTACCTGAACTTGTTG
CGATAGTAGACGCCTCGCTTACAAAGCGAGGCGGTTTGTCCTGGAGTGAGACGCGGCGTAATCCATGCAGAGCACGCACTGACGATGGATCTGAGGGCAC
ACTTGGGCCTAAGAAGCGATGTGACACCAGTTCGTCTTGTCCTTCACCGAAATCCGCAGTCCCGCCATAACCAAGCGGTGTTCCCAGGTCTgcaccttcc
tcttcaccttcagctACTGGCGATCCCTCATGATCGTCGCTGtcactttcttcatcatcaatatcatGATGCACTAGGTTCAGAGGTGCCGGTCGCTTCG
GCGATGGGATCACTAGCTCCACTTCCTGCCCAACATGCTGTCCCTCCTCATCGTTAGCGTCATTTCCAGCGACTGGTGACATTGGTGGTGTCCCTTGCGG
AGATTCC