Description :
From Genome Similarity Track
Location :
Scaffold_3373:480- 1849
Transcript NameFunction/comments
Phyta_totarag15246hypothetical protein

Sequence
1369 bases(100 bases per row)
TAGTCGAACAGCAATCCACCACAAGACAGATTCGACAACGGTCCCCAACTCGACTCATCGTACCCGATCCACTTGACCTTAAACATCCGTTGAGTTCGGG
CAGTGTCTGTAGATAGCGGCAGCTCGTCATCTAGGATTGCTTCCACCTCATACTTGTCATCTCCTTCCTCTGGCTCCCAACTATCTTCTGGTAGAAGTtc
ctcgtcaaagtcgagTCGCTCGGActcggcgatgtcgtccactAGCCGAGTAGTAGGCCTCTTGCCGGACTGCGTGACCGCCTTCAGTCGAGATACATGG
ATCACTGGGTAGAACCTGTAGCCACTCTTGTCAGGAAGCTCGAGCTCATACGCAAATTCTTCtaccttcttcttcaccctGAACGGCCCATGCCACGGAT
GGGCtagcttcttcgtcagccCCGGCCTCACACGCTCCATGAATATCCAGACTTGGTCTCCTTATTTGAACAATGATTTCTTCGACTCGGCTGattcatc
ttcaccttcggCTTGATCTGTATCGTCTTCAGCCGAGTTCGGAATGGCTCTCTGCTCGACTCGGCTAAGGGCTTCGTTGTGCTCTCTCGCTCGACGGGCT
TTCTCACGCAACTGGTACTCGGCTGCCAAGCGTAGAGCAACTTCGCGTTGGCGGTTCGCTTCCCGACGTCCTTCCACTGCGCCAGCCGAGTTCGCCGAGT
TGAGGTGCCCCTGTCGCACTGATACGGTCATGGCTTTGAGAGTGAATCGTGCGTCCCAACCGTGTACCAAGTAGAACGGAGTCTCCCGCCGAGTTGAGTC
CCTTGAGTTGTTGATCGCATGcaccatcttctcggcgatgtcgtcccAGTCGGCTTGGAGCGGGTCTTCGACGTACACCCGTACAGTTTGAATCATGGTC
TTCATTGAGCGTTCCTGCTGTCCATTTGCTTGGGGTCGGTAACTCAGCGTAGCCCTCGACCTCGACTGCATCATCTCGGAGAACTTCTGGAAGGCTTCAC
TCATGAACCTTGGACTTCGCTCATGCCGTATCAGCGATGGAGCGCCAAACCTCCTGAACACACACTCCTCAAAGGTTTTGGCTACTTCCAGTGCCCCCGT
ATCACTCATAGCTTTAGCGATCACGAACCCCGTGAAGTGATCTTGGAACAGGAACAGGGCTGTGTTGCCTCGCCGAgagcgtggtggtggtatcACGAAA
TCCATTGACACTACTTGGAATGGCCGGTCAGACACCACGTTTCCGGGCGAGTAACCCCTGAGATGAGgtttgctcttgctggtaCTGCAGTCTTCACACG
CTCTGACATGCTTGATCACGTCCGCGTATAACCCAATCCAGTAGTAGTCGGCTTTCACACGGTGGTATG