Description :
From Genome Similarity Track
Location :
Scaffold_463:48- 5354
Sequence
5306 bases(100 bases per row)
CAAAGCCTGGTGGCGTCAACACCGGCTGAGCAGGTCGAACGTGTCAATGCGTTTGACACGTATGAGCAAGGGCTCATAGCGCACGTGCGGGGAAACCTGC
AGGCGCCGGCGGCTGAAGGAAAGCCGCCTCACCCGAAGCCATTGCGGCTAAAGGTGACACCTTACGAAGGGAAGGAGGGAGAGAACCTTCACTTCTGGGT
TCGAGAGGTAGAGCTCGCGATGAATGCGGCTCTGATCTCGACCGAGCAACTCCGCGTTGCTTATGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGG
GCGTACACGCGGGAGGCGACATCGCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCGTTCCTCCCGGCGAACTATGAGTATC
GCCAGCGCTCACGCTTCCTCTCATGCAAACAAGGGAAGCGTGAGCTGCACGAGTACATCCAAGAGATGCGGGAGCTTACGGCATCCCTAGTGGGCAACCC
ACTGAATGAACACATCAAGGTGACAGTGTTCATGGACGGCCTTCGAGTGGGCCCAGCGCGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAG
GCGATTCAAGTGGCCCTTCAAGAAGAGTACAGCCACCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCAGGGAGTTCATCGCAGAACCCCAATCGGGCAA
GCCCCAGCGCACCAGTTCCCATGGAACTCGGTGCCGCCGAACAGCACGATATTCGCTGTTTCGGCTGTGGCAGGCTGGGCCACTTCAAGCGAGACTGCCC
CGCGGAAAGACACCGCAGACGGGCTTATCCCAAGCCCGTCCTCAAGGGTCGTTGGCAGAAGCCAAGACCCCGGGGCCAGGGGAACGCCGGAGACCAGTAG
GGGCGGGGCGCCCTACTGGGGAAGATCTAAGTCTTCGTGAGAGGTACGCAGGAGGTGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGA
ATCGGCGAAGGGCAGCGATGGGCTGCTTGTTGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGATTCTGGGGCGTCGCGGAAT
TTCGCACGCCGCCGGACGGTTGCTCGTAACAGCAACAGGTTGACCGATGCTTTGAGAGAAAGCAAAGGCAACGGGGCAGTGTCAGTAAGACTGGCCGACG
GAAAGGCCGTCACTGTCCCCAATATCCAGATGGATCTGGCTGTCAAGTTCGAAGACTTCGACAGCCTCGAACAGTTTACTGTTCTCGACATGGATCCATA
CGATATGATCCTGGGCATGCCCTGGCTCGAGAAACATGAGCCTTGGATCGACTGGCGAGGCAAGGCAATTGGTGCCAGCCGCCCTGCAGTGACCGACAGA
GCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCTGGGGCGCCCGCAAGGGCCGCCAAGGTACCGAAGCATCCAGCGGATGCTTAGGAGTCGTCAACG
TATACGACGACTCCAAGGAAGCTTCGAAGGTGGCGACGCAGGCAGGCGTCCGCCAAGTGGGTAACTTAGGTCCACATGCGGGTAACAGAGTACCGCAGAC
GGTCGCCCAGACCTTAACTGAAGAGGAAGACGCGGGATGCGCTTCCTGTGTGGGTAACATAGTTCCACACGAGGCCTCGAGAGCCTCGGATGTCAGGATT
AGGACATCCCAAGACGTGGGTAACGAAGTTCCACGTCACGGTCGCCGTCGACGACGCCGCCGCCGCCGCAAGTCAAGTCTGAACCATGTTCAGACTGGAG
TCGTGCACAACGACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCGCTCAAAGGCTCCAACTGTGGAATGAGCCACAGCCGCGTCCCCGCGGCTCGTCGAACCCTTTCGACACGGAGAATGAGAGTT
TGTGACTCTATCTCCCGTTTGTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACAATACCCCAAGTGTACCCAAGTTACATGAA
GAGTGCCCAGTCACTCTTGAGATACCTGGTACATGGTACCAGGGGCTCTAGGAGCCAATCATTGCATATCTACCTAGATTCAGTATAGGTAACTTATAGT
TTGTATTAGATACCAAGCTAAGTCTACCTATAAATACATTCAGTCTTAATCGTACCCTCAAGTGAGTACTTCGTCCCCTTCAGACCAGGGACACGTGAAC
GGTCGTTCACTTAGAGTTTGTATACTCTAGAGGAAATAAACTTCCTCTGCACAAGGTGCTGTGTGACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGCGGACGT
GGTCACGAAGAACCCACCGTCCCAACTCCCACCAGACCGTGGAGTACGGCACGAGATTGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGGCAGTGG
CCTCTCCCTCGCGAGCAATGCGAGGTGATCGATGCCTTCTTCGCTGCGAAAGCGAAGGCGGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCGA
CTTTCTGCGTTCGTAAACCGAACGGGAAGTGGCGTCTGGTTCACGCTTTTAACAAGCTGAACAGCGCAACGGTGCCGGCCCAGACACCAATCCCACGAAA
GGATGTGTTGTTAAACAACATGGCCGGTTGCGTACTGTATAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCG
CTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCCTGTCTAATGCCCCAGCGACGTTCAATCGCTTGGTGATGC
AGCTGTTCCGGCCGCTGCGAGCCTTTGTACAAACGTACTTCGACGATATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCACTT
GGGTCACCTCCGTCGAGTGTTGGAGGTTATGCGAGCCAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCATCGCCAGAGATCAAAGTTCTCGGT
TGCTTCGTCAGCAACGTCGGGGTTCGAGCTGACCCCGACAAGGTGAAGGCCATTGCAACGTGGCCGACACCCAGATCTCAGAAGGATCTCAGGAAGTGGT
TGGGTTTGGCCAACTACCTCCACAAGTACAGCGCAGGGTACGCGGGTCTCGCAAAACCCTTGTCGGATCTCCTGAAGAAGGATGCCGACTGGCGCTGGGA
GCAAACGCACCAGGACGCCTTTGACAGCGTCAAGGCCAGCCTGCAAGAGGCGCCGGTCCTGGCTTTGCCGGACGAGTCGAAGCCATTCAGCGTCGTCTGT
GATGCCTCCGACTATGCAATCGGTTGTGCACTACTGCAAACCGATGCAGCTGGACATGAACGAGTCATTTCGTTCCAGTCCAGGCAGCTCAAGGCTGCCG
AACGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCGATGAAGTATGCCCTAGTGAAGTTTCGGGTACATCTTCTGGGCTCAAGGCCCTTTGTGATCTA
CACAGATCACGCGTCCTTGCGGACGGCGACGAATTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATGAGTTCCGCGTC
GAATACAAGCCGGGCAAGCTGAACGTGCTTGCTGACGCCCTGTCGCGGCGTCCGGACTATGAGTTGGCCCACATCACACGGGTGACAACGGATCTTTACG
ATCGGATACGCGAGGCGTATCGGGACGATGAGGCTATTGCGCCTATCGTCAGGTTCCTAGCAGCAGGAACGAACGCAAAGTCCGACTGGCTTTCGCCTCG
GCAGCGTTCCCGGCTCCACCGATATGAGTTGAGGGATGGCCTCCTCTATTTCCGGGTGGAGCCTAGTGATCCTTCACGGGTGGTCGTACCCAACAATGAG
GATCTAAAGTTTGATATCCTCGCGGAGGCGCACGATGCGCCCTCCAGTGGCCACTTGGGCCGTGAGAAGACCTTTTTGTCGGTTTCTCAGGCCTTCTGGT
GGACCCACATGTACAAGTGGGTCGCCAAGTATGTGAAGACATGCGAAACATGTCAGCGGGTGAAACCCGCAGGGCACGCTTCGGCTCCGTTACAGAGCCT
GCCCGTACCTGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGACTTCCCGCCGACAGACACGGCAACACCGGGATTGTGGTGTTCGTGTGT
CGGCTGAGCAAGATGGTGCATCTTGCTCCGGTGCCCGTTACGGTCACAGGCGAACAGACGGCACGGCTGTTCGTCGATGGCGTGTTCCGCTATCACGGTC
TGCCTGAGACCATTGTCTCGGATCGAGACCCGCGGTTCACCGCTGCGTTCTGGAAGACGCTGTTCCCATTGCTTGGAACTCGTCTGCAGATGTCCACTGC
CGACCATCCGCAGACGGACGGCCAGACGGAGCGCGTCAATCGAGTGCTCGAAGACACTCTGCGCAGTGTATGCGCTGGAGCCCCACATACGTGGTCGACA
CAGCTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTACACGCGTCTACGGGGTTTACGCCGTTCTACCTGAACGGCTTCCGTCACCCCAGAGTGCCAC
TCACTCTTCGAGGAGACTCCACGTCCTCTATTTTAAGTGGGGGAGAGGCTCGGAAAGTCCTTTCCTCCCAGGTCTCAGATGTGAGACCGGTTTCACTGCG
GAAACAAGTGGAGTCCTTTATGGACACCAAGCTGATTGTGATCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGACAGACAAAAGGAGTACTCAGAC
AAACATGGAAGAGGAAACTTAAATGTGTTTAAAGTTGGTGAATTTGTGTTACTAGACACTAGAAACCTACCGCTTGACACTGTCAGCTCTGTCGGCAGTA
ACAAGTTGAAGCATCGCTTCATCGGACCGTTTACAGTCCTTGCCAGACATGGTGCGTCGTACACCATCGACCTACCAAAGTCAATGACGACGCACCCGAC
GTTCTATGTCGGACGTCTTAAGCGGTACCATGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGTCCAGCTCCTCGAAACGAGGAGCGGCCTCAG
ACGTCG