Description :
From Genome Similarity Track
Location :
Scaffold_491:48- 3501
Sequence
3453 bases(100 bases per row)
CATCTTCGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAAACACAGTGTCCCATTCGCCAGATCCAACCTCACTCCGGCT
GGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGACCCCAACCCAAATATCGAACCGGTATACCAAACAACCTGCCAGCGTGACCTTGAT
CCGCGTTCTCCCATTCGTATGGTACACGCCTTCACCAATTTCAACACAATCTAGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCG
GTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATTTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTG
GGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCTACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACTTTAGG
GGGATCCGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGACGCTTCTCCCAGTGACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTT
GAAGAGACTCCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGACAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTA
GGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCGGGCGAGCGTCC
TAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACT
TGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACATACCAGATGTTTCCA
GCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCG
GGTACGGTATCCCTCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGTAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCG
AACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCC
GGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGC
CTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTA
GACCGGCCACATTTAGTCGATGTAGGTATTCTAGCAGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACA
GTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCCTGGTGGATCTGCCCAGCTGCCTATACCAGCTCCTGGCTGGCCCCGCTAGCAGATC
CGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGGTCCATGTTCTCGCTCGGTCCTCATCTTGATCC
TTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTG
ACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGGAGTTGTCTCCATCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTG
GAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTG
TCGGAATAGCCTGTGGCCGTCTGGCCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCCGG
ATCTGGCTCGATCCTGGCTGGATTGTGTCAGATGACGCGTAGGGTCTACTGGATCCCGAGCCTTCACGCTCACAGGGGCTTCCTGTCCTCGGATCCTCGC
CCGCGCTTCCAGCATGGATGCCCCGGAGGGTCTTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCAACCTCAGCGGCGGATTCGTAGTTCGAG
GACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTCTCTGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGA
TACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCC
ACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTTGATCTGGCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGA
AGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATTCTTGTCTGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCAT
CTTCTTCCGCGTAGTCTTACTCGTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGAGTTGGGTTTCGGTACGGTGTTGGCTTAACCGGTGAATCTGCAA
ATGCATACCGTTTCGACTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAG
AGGTTTCTCTTCTAGATCTAGATCCGGTAGGTCTAGATCAGGATCCACCTCTCTTCTGTCGACAGAGTTACTCCCAAAACTCCATCGATCCGCGGATCTT
GTTTCATTCAGCAGCGTCTTCGTTGATCCGACCTCCGACGACGCCTCTTTCCCTGACTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATC
CTGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGGGTAGCGGGATCAGCAAAATCTGCAAGATTGCTGGATCCAACTTACCAACTGCGCCCAGAC
ACCGACTAACGGAGGTGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCAGGATCTTGCTCTCTCGGTAACT
TCCGAAGAGTTCAAGTGGTAAAGCTTGAATGTCTTGGCGAGACGTGGGGGTGG