Description :
From Genome Similarity Track
Location :
Scaffold_2997:48- 2451
Sequence
2403 bases(100 bases per row)
CAGGGGAAGTCCCGTGGATACTGAAATTACCTGCCCCAGGAAAGCGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACT
TCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGACGGGAGTCGGATCCAAGATTGTGTTGGGATT
GGTGAAGGCGTATACCGTACAAACGGGAGAACGCGAATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTG
GTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCA
GCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGAC
CGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGG
TCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTC
AGTGGGATCCCGCCGCTACAGAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACT
GGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGATAGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGG
GGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGATGGACGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGT
GGATCCAAGCTTTCCACTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACGCTAGTCAAACCCGAACCGTCGGGTTTAGACTCGTTAGAGGACCGG
CTGGATCCGACAGGTGACTTCCCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGG
TGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGTATGGCGGTAATCCCGGAGGT
ACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAA
AGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCACGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAA
GGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCAGATCTTATTAAGGGCTTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGC
GTCGCCGGTGGTAATCATCATCAAGAAGAACGAGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCA
ATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGCACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATC
GAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCT
CATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAA
CCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAGTGA
CATCCCTACTAGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGTGGTTAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTGGGCCATCGAGTTTC
CAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGTCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTG
AACTACTACAGTCGGTTCATCGAAGATTACGCTTTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTGTCC
GGA