Description :
From Genome Similarity Track
Location :
Scaffold_1033:48- 1191
Sequence
1143 bases(100 bases per row)
TTTCCCGAGAGATTTGGTGCTAGCGAAATGATTAGACATGATCGAGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCATCCGGATCCTAGGGCAGC
GACAGCGAGCAACATGGGTATCGTCCCCCAGATAACGGTCGGCCGAACGCAGGTGCAGACGATCCACGAGAGCACTCAAGAGGTATTTCCAGGATTGGAT
CAAAAGGGATTGGATGAATACGCAGAAACGGCTCCCCTTCGCGATGAACACCGCCCCAGACAGAATTCGGGGGTGATACCCCCTTTTTACTTGTTACTGG
GGGGGGATCCCCAATTCCACCCTTAGAAGGGCCCCTTTCCCTTTGGCCTTTCCCAAGAAGAAAAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAG
AAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAATGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAA
TCCAAGTGGGTTCGCAGGTGTGGCTGTATTTGGATCGAGTGAAAGAAGGGTACGCTCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGAGA
GAAGATTGGAGAACATGCGGTGAGGCTGGAAACGACAGGTACCGAATATCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATAT
CCGGATCGGCCGCAGGTCCGTCTTTCGGTAGATGCATCCGACCGCTCGACTGACGAAGTTTTCTACCGGAGAAACATGGGAAATTGGATTTCCAAGCCGC
AGCATTTGGAAATGCGAGAGATTTCAACGATATGAGATGCGGGGAAGTGAAACTAGATACCGAAGAGATTTTACCGTGAGTTTTCGGGTGCATTGGCGAG
GATATGACGAACCTAGCTGGGTAGACGAGGCAGATCTGATCTGAGCAGCGTAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTC
GGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAAGGGACCCATGGATGTGAGTTGGTCATATCGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTG
GGTCAGGAGGAGGAGGATCGCTGATATGAGTTGGTCACATCGG