Description :
From Genome Similarity Track
Location :
Scaffold_992:48- 10908
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_992-snap-gene-0.3Protein kinase
Pytul_var.sporangiiferumsnap-pug3_contig_992-abinit-gene-0.13Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_992-snap-gene-0.5CREG
Pytul_var.sporangiiferummaker-pug3_contig_992-snap-gene-0.6Phosphatidylserine synthase

Sequence
10860 bases(100 bases per row)
ACTGTCCCAGTTACTCCAAAATGGTTCATTCCACAGGAGTACATTGAACTGATCTCAGGAAATCACGACGAGTGGCTGGGTGTGAATGTGATGCTGTCCA
CATTTCAAGCGCCCTTTGCAGATTTTGAAAGCAGCACTACTCGATGGCTCCATTGTCGGCACCCGCATGTGACGAAGCTGTTTGGTGTCTGCCACCTCAG
TAGTCCTCGCTTGCTAGTTATCGAGCACTCGCCGAATGGGACGCTGCGCGAGTTTTTGCAAACCGGTAAGACCCAGAAGTCTATATGGCATAAACTTCAC
GAAGCAGCGCTTGGACTTCAATACCTCCACCGCCACAAACTCACTCATGGAGACCTTCGAAGCGAGAATATCGTGATGAACAGCAACTTCGAAGCTCAGA
TCACCGGAGTGGGACACACTTCGACCTGCATGGACCCAGGATGCCAAGAGTACAAGGCATCAGAGCTTCTATGCCTTGAAGAACCATCGCTGGCATCTGA
CGTCTGTGCATTCGGAGTTTGCATCCTGCAGTTCATCGTCGACTATTTGCCAGATGGAGATCGGGGATATGGGAAGCGAGAGTGGCTAACATCGAAGCCA
CACGGAATGGATGATGCACATTGGCGCCTCATCACCGACATGTGTAAACAAGATTCAAAGGACCGAGTAAAGACCACGTACGTCGCCATGCAGTTGAAAC
GATTTTCGAACGGCGAAGCCCAAGAACATCGCGAACAACACGAGATGGAAGGCGTTGATGCTACAACATACTTGATCCCGAGATTTCACAAACCGTTAAT
AAAGCTGTCGATATCTTGCAAAAGAGATGCGCCAAGTGATCTATAATGCAGCAAATGGCTGGCGTTGAGCTGGCGTGCGTGTCTGATCTGCACTCTCAAC
TTGAACAGAAAGGTGACACGTGTCCAGGGTTTGCGGTCATTGAGCTCGGCAACATCCTGTCTCAATTCTTCCTACTGCTGAAGACACCCATCTCGATAAC
CGAGCGCACGCGAAGTTTAAAAGTCGCAAGACTGCATCAGATAGTTCACTCGAAGCTTGACTTCTACCAGGCAACAACGAGGATTTTTGAGACGTTCGAT
TCACAAGTGGAAGCGCAAGTACAGGAACGATACGAGTCAGTGGAGCGCAGGCGCAAGCACTGCAGCAGCTGACGATCATGGCGTTGAGATACTCGACGTT
CGCGTCTCTAAACATGGGCTCCCACAATCTATTCCGGCGGTACCTTCGAAGTCACTGTGGTACTTGCCGTTAGGCGAGCTCTCTCGTTCATGCAGACGAC
TCACTTGCAGATGGGTCTTTTGGAATTGTGCGAAGTGGAGATTGGCTGGGCTGTGTGATCGCTCTCAAATCCCTGGGCTACGAGGGCTATCCCGACAAGG
TCAGTACCAGACTCTTCTTGCACGAAGTTCAGGTCTGGTCCCACCTCAAGTACCCTCACATCACCGAGTTCTTCGAGACGTGTCATGTCCGGAAACGCTG
CATTGTGTGCACGTACGTCTCGAATGGTACGCTGAGTCAGTTTTTGGAACTCGAAGAAAACAAGCACCTGGTATGGGAGAAGTTCTACGAGGCTTCGTCT
GGGTTGCGCTATCTGCACAGCCGCAACATTGTCCACAACGATATGAAGTGTGACAACATCCTGGTTGGCACAGACCAGACAGTGAAGCTGGTTGATGCTG
GCTTGAGCTCAATTCTAGGTGCTGCCGAAGTGAAGGTTGCTCCCGATTGCATGGGCGCTGCAAATTGGAAGGCACCAGAGTACCTTAACGGAACTCGACT
GTCCTTTGCCTATGACATTTATTCGTTTGCTATGTGCGTCCTGGAAGCTGAGACTGGTGATATCCCGTGGGCTCGCTATACGCCAGTCGGATTGGTTGCC
CATCACCAGGAACGTTATTTACTTCCAAAGAGTATGATGGACGAACAGTGGCAGCTAACTGAGAGCTGAACGTGCCGGGAACCGGAGGAGCGCGTGAATA
CGGCTCACGTCGCGCAGAAACTCTCCGAGCTTGCTCAGCGTTGACCACGGTTTGTGAGAGGAAAAGAAGAACCACCTTGCGCAATTTATATTCTTTAAGG
ATAGGTTTAGTTAACATTGGAGAACCAATCAGTGCGTTTGATGAACAGGATTGGTAGAAAATAGTATCTTAATACAGTTACTATTTGATAATTTGATAGT
TGGTGTGTACTACGAAATAGATGGCCTCACACCAGTCGTAGACGCGCTTCAACTTGGGTACGACAAATAAAATATGCAACATCCTGCCACAAATCTCATT
TAGGTAGAATTGCTACGGTACTACGTGAATTTATCGTCTGTATGCGGCACATACGCTATCAAAAGTTTCGTGATATGCACTTCGACGTTTTGTTGGCCCT
TGGCAAAGGTTGTTGTAAGGCCAAACTTTATAGTCGTGATGTCTACTAGGACATGTGATATCTTCCAGCTTCAACTTGATTGGCTGAAGGCATGACGGTA
GCACGAAGTACAACATCCCAGACACTCATCTTGCCCTTTGACAGGCAGCCGCGATGACGACGATGGGAGGGTTCATTTTAATAAAGTGACCAGTGACCTG
ATTGGCACTCACTGGTGGTCCACCACGGGTGGGTCTCTCTCCCATCAAGTGGGGAGATGCGGTTGGTCATGGCGCCACGGCAGGAAGCGTTGGCACGTGC
CACCGTCGCAATCACGTCACGTCACTCGCACCAACGAATTACAGTATTCGAGTCTCATCTGCGACCACCGACGCACATTCATGACGGATATACAATGCTC
TTTTTCCAACCCAATTCATTACGCATTCGTATGCTCCGCCAGATAAGCGCACATGGCGATACGCTATTACAGATCATCATAACACTCATTCCACATACAG
AGACAGACAATAACACTAACTACTGAAGCGCTACGGCTTCTCCCTGCTTCAGTAGATGGCTTACAATTTACATGGGGATTTTGACTCAGCTTGAAGAAAG
TCGCTGCACAAAGACGTGCATCTGGTTATGACCAATACAATGTCCGTAAGGACATAAGTAAAAACCTCTGATTGGCCAAAGGCATAAGCAAAGAAAGAAT
AACGAATTTGGGAGCACATGTGCATCATAAAGCGTTTGGCAGCCCATTTCGCCGTCGTCGTCACTTTGGATCTTGCTGCGTGAACGCGACGGCGACAACG
ACGACGACAAGCACCATGAGCGCTATGAAGAAGAACGCGACGACGCTGCATCTGCTGCTGACGGCGCTGCTGGTGCTGCTCGCTGGCAGCGCGTGCGACG
CGCGCCGCAGCTACATGNNNNNNNNNNNNNNNNNNNNNNNNGGTTATGATCCTCTCTAGTGTCACGCCGTCCACTGCGTAAGCCCATGTGTACATGTAAA
TGCTTACGTGTGTGCTTTCTGTGTTGACTGACGTACTGTTGATTTGATGCACTCAGAGCCCTCCATGCGCGTCAGTTGGTGCATGAGAACGAGTGGGGGA
CGCTCGCGACCATCTCCAAGCAGTTTAACGGCGTCCCGTTTGCCAACATCGTCTCGTACAGNNNNNNNNNNNNNNNNNNNNNNTTTACTGAGCGTAGCTC
CTTCACGGGACCAGTATGTATAACCTTATGCTAACAACTTTGTTAATATGCTATTGTAGATGGCGTGGGCGACTCGGCGGAAGCGTCCACAGGCGAAATG
TTCTTTTACCTCACGCCCATGGACTCCACTGGTGCGTTTAGACTATAATCCAAACGGCAATATCGTATGATAAAAAAAGAAGCTGACGCTGCTTATTGCT
ATTATTTGTTATAATAGCGAGTGACCTGGCGGTGAACCCAAGCGCGAGCGTGTCGATCTCGATGGCGCAGGGTGGCAAGGGCGCCTGCAAGATGGACGTC
GAGGACCCGACGTGCTGGAAGCTCTCGTTCACCGGCACCGTCGTGCCCGTGCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAAG
GCGCTGTTCTCCAAGTACGTCCCTATAAATTTGTATACCTCATATGCTAAAATGGCTGTGGCTAATGAACAAAAACTGCTGTTTGTTTGTGTAGGCACCC
CCAGATGAAGTACTGGCCGAGCGACCACGGCTTCAGGCCATACGTGCTCAAGCCCGAGAACATCGTGCTCCTGGACTACTACGGCGGCGCCAAGCATATC
CCCGTGGACGAGTACTACAGCGTCAAACTGAGCGACGAGAGCAACGACGACATGGAGCAGCGCTTCCGCATCCCAGAGTATTACCGCATCAAGCACTAAC
TAAGTAAGCGCTCGACGCCACCCACCACCTGTGGATCAGATGCATTCAGTACCACCAGTCTCTTTGTGTTTCAACTCTCTCTCTCTCTCTCTCTCTCGTG
TCCCTTGTTCGTCATTCACACACTGCAAACCATGCATGTCATGTTCCTCCTCTCTCTCTATTCTATTCCCTGATATAAAAAAATGCAAAACGTGCAACTC
GCAATCTCCACCACCCATTTCTTTCACTTAGTAAGCCCACTGCGTGGTCAGGAGCAGCAGCGGCGTGAACGAGAGCCAAAAGAGCACATCGAGTTTGCCC
CACGTGGTGACCTGGTAGAGCTTCGCGATGCGTGGTGATGCATGCTTTGGGGTCGCATTCCGTTGGCTGGCAGATGAAAAGAAGCACACCATCCAGATCG
AGAACATGGCCACGAACGCCAGAATCGGGTACAGCACGAACGCCGGCGGTGCGTCGTTGAAGAGCACACCGTTGGCCGAGAATTTTACCCACACGAGCAC
CTCAAATACCGCGATCGAGAGGATCATCCACGCGTTTTGGCCTAGACGCTGGCACTCCGGGTTACTCAGGAATTCGTAGTACTAGGAGCAGATACGAGCA
CACAAAAAGAGATTCTGGTTAGCACAAACGCATTTCAAAAGGGCACATTCAAAATAGCCGCTTGCTTACCTCGGCTGCGCCTGGGATGCCAATGAGGAAC
ACGAGCGACAAGCGGTAGGCGTTGAAGTTGCTCTCTTTCGGGATGCTCAGCGTGTTCAGCAGGAAGAACGCGTTCAACTCCACGAGCAGACACACGAAGA
GCGCAAACATGATCTACAATCAGACAAAAAGACACAAGTGTCAAACGCCAGTAAACTTAGGCTCAACGACGTCAAGCCTGGAAACGTACTTGGGCAAAGC
GCTTAAAGCTTGAGAACACTTCCCAGTGGTATTGCGACCAGCTGATCGGCGTGAACTGGCTGAGCACCAGGAGCATGTAGCCCATTTTCTTCTCCTTCTT
GCCCGACCAGTCGTACTCCTTGGTCTCAAAGTACCAGAGCGTGAGGCGTCCCAGGAACATACCCAGTAGGTTGGCGCCAAGGAGGTCCATGAAGAGCGAG
TCCCACCAGCACTCTTGGAAATCCGGGATTACAAACTGGAACGCGAGCTCCAGAATCTCGAACGCGATACTGAGCACCCAGCAGAAGCGCCAGTCGCGGA
ACATGCACATCTTGCCCCACCACCCGGTCACGTGCGCAAGGAACCAGATGCTCGACACGCCACGGTATATCGTGTTGGAGTTGATGTCGCACTCCAGCGG
CGCGCCTGGAGCCGCTTTCTTCATGGACCCGACCTCGGGAAAGAGAAACTGCATCGACAGGATCGCGCCCTGGCGGTTTTGCACCGACATGGCTGCAAGC
AGAAGCAGGTACACGACCGAGCAGCCATGCACGATACGCCAAAGTCCAGGATGGGGCCGCACCTACTCATATGGAGACAGCATAATATGCAGGTTAGACG
CCATTCGTGTTTATGACTATACCCAACGACGTACCATGAGCCCATCGCGCGTCTGCAGGAAGCAGTAGACGAGGAAGATCAGCACGCCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCACATCCTAATGCATCCAATAGCCCCCATACATCACAGTCGTCAGTATAGCATCTCCCC
CCTTTGGCTACTCTACGCAAATATGACGCACTTGCGAGTCGTGGGTGAACGAAAAGTAGGACACGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCAGGTTCTCCATGTCGCTGCCGCGCGCGGCGCGGAACATGTTGTCCGACGAGAATGCCTCACCGAG
TCGCGGGCTCAGTCCCACGTCGCTGCCTGGCGACTTGGGCTTCTGCAACGGTGGCAATGGAGGCTCACGCCCGCCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCGTTGCTGCGGCGCTGGCGCAGCTGGTACCGGTGCGTGGCGCTGGAGGAGGACGCGATCGCCTTCGT
GTCGCTTGTAGCCATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGGCCGCGTGGCTTTTTGGCATCATCCATCATACTTAGAGAGAGCGCACACAATTTATTGGCCTCGGATAATACGTAGATGCTAAATATCCTGT
TATATAAAGGCATTTTATGGATGTTTTGTCTACACTGGAAGCAGCTGGATAGAGGGTATGTGATACGAAGAGGGTGAAGGAGAGCATTTGTCAGCCAGAC
AGATTAATTTGCGCCGGATCAGATTCCTCAGCCATACAAAGCGAATCTGAGTCGGATGCACAGACTCAGCTCTACATTGCAGGCGTCCGCCGAAATGACA
CACTACATGTAGCGCGAATGCGCACATTGCACCTGTGCTCCATAGCTACCGAATCGGTAGCTTCTCGTGCGACACAAGCGTATCGCTCTCTTTCTCTATC
TTCATGACGCGGTTGGCGTCAGTCATCCGTTGCCAGAGTTGCCTTTCCGGCGAGAGAGCAGCGCATACCCACCCTTTGACTGTCGAAATGACGCACGTGG
CAATCAGTCGTTCTTGGTACCGGGTCGCTGCTGGCAATCACGACACCTCACGGCACAATGGAACGCATTGCTGCTCATGCGCGAGGTTACAGAAAGCCCA
ATCGCTCGCTTGTCACCAGTCATCCTCCTCTGTCGGTTGCCTTTTCAGGGGTGATGCTGACGCATGCACTTTGATGACAGGCCGCTCTCGGGGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCTGACTGTCTCTACGGCGGAGACATATCGAAGGACAACCAGATTGCATCATTGCTCCATGAA
GCGTAACGTAGTGCACCCATGAAACTACTGTAGCTCTCTCTCTCGTCACGAAAGAAAAAGAGATCGTCGATCGTATGCTGCGTGGCACGACGCGCGCGTC
CCTCACNNNNNNNNNNNNNNNNCAGTGCAATGCCGCAACGCGAACAGCCAGAGGGGAACCCATGGGTGTCTATGTTTGCAAGCGCTTGATTGCACCACGC
GCTCTCTTCCGGCCGTCCTGTGTGCGCGCCACCCACCACAATCAGACGTCCAGGATGGGGAGGAACAAATTATTAAAACTTTCGCCATCCGGACATCTCA
ATGGACACAAATCGCGTGGTGGCGCACCTTTGGATGCGCGATCAACACAGACAAGTGTTCATTTATTGCAGCACCGAAGGATACTTTTCGTTGAGTACAA
CGCGCGACGCGAATGGATTGGCCGACCACCTCCCAATCTGAAATGCTCGGGAACAGCGCTGGATACCTACTGCACTGGAGCTCTTGCCAAAGCGAGCGTG
TGCAACGCGACTGGCGTGTTCAACGTTCAATGAGCAGTGAGTGGATGATCCCGACAAGTGAGACCGTCATCGTCGATCTCACGTAGTGATTGTGTTGCCG
AGAGGCACAGCGCAAGTGGGGACGTCAATAATAATGCAAGCAGCGCAATGGAAAGTGCATGCAACCGGTCTGCTGCCTGGGCTGACAGCGCGGAAATACG
CGAGCTAAAGAGGGTTTTATGAGGCGAGTGATGAGAGGGCGAGCCTCTGGGGTATAAACGCGAGGCAAACGTCGCGAGGAGACATGGACGAGCCCCATTC
TACACTCTCTTTCCGACGATGAGTGCGCACGCGGGCGATTGCTTGAGCTTGCACGCCATTTGTGCCTGTGGCGTCAGGCGGAATACTTACGCAGTGATGA
TGGATGGATTCTCGGTGAACACTCAGTCGCGAGCCCCGGTTCACTTCGTTTTCTTTCCAATTGCCTACATGTCTCTTCTACATAGTGCTGTGCAAGCAGC
GCAATGCCCGCATCAAAGAACAGCGGCGCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCACGACTCACCTTATCAATAGAAGATAGCACAG
CGTCACAACCTAAAGGCTGCGCTGAACCTGTAAGTTAAGAAGCGGCCAGCAACTGTCAAAGCGAACAATCAAGATCGATTGATCGACTGTCTGTACCGTG
AAGATGGGGCGCGCTCGTCCATCATCTTTCTGACCTGATTCGACGGTTCTCTGGTGTGTACTCGAGCGGATCGTCTAGACGAATCTGTCGCGCTTTGGAC
CTGCAAGCTGCAAGGGGATGGCAAGGAGCCGAATGACTAGGTAAACGTGGGAGGCTGAAAGGCTAGAGAGAGGGAGAGAGGTGTATCATGCTGCGTAAAC
GAATCGTCTGCATGACTAAATTTTACTTTACCCATGTTAGAAAATGGGGGACAAAAGCTCTATAGTATCCTATCGGATACGCTCTATTCTATCCGTGTGA
CTCAGCGAAATTGTGAGCTCATGCAGCGACTTTCTGTGAGACTTTCTCGATACAAGGACGAGCACAAAGTCCTCACAAGTGAGGCCAGAGACACACAGTC
CTACTGCACTGACGTGTCCAGTTCGATAGTCCGCCATTCGATTCCTTTTCTCTCTCTCTTTCGCAAGACAGAGAATTAGACTGTCCATCCTGCTTCAAGA
CTCAAGTGCAAGGATAATTTTTATTAAAATCCAGGCTACATATGTCCAAACGCCTCGCGAGACGGCTCATCTTCTTTTGAGTTAGCGAGCTGCAGTGCCA
TAATATTGCGTTGCGTTGCGTAGTGCAGTGCTGCTGCTGAGTATCGAATTGCAATACAAGTTTCAGAATCCAACTGAGGCTGTTAAAACAATGCCAGTGA
CGAAATGGATACTCCGCGAGCCTATTTGTCTTGGTGATGTCTACATGTCTACATGCATGGTTGTATGGATTACAGCAGAGAGCAGCATCAAAGCTCTGGG
TCCAAACCAGATCCCACCCCGAGAGGCCTCGGGGTTNNNNNNNNNNNNNNNNNNNNNNCAAAAGTACCTTAACTTGAATGCCACGGCCATCACAGAAAGT
GTCACTCTAAACTGATTCACTCGCCCAGATTTTAGCCTAGAGGGCAGAGCCATGCACGTGGCCTCCTCTGAGAAGGTAATGAGCTTGGCTCAGCTCACTA
AGGACGCTTTTCTCTTCGCAGTTTTGGTCGCGCGTCATCCATCAGTGCCGAGACACAACGGCAATTGAGGTTCTGTAATAGAGCGTGTGTGCGCTCTATT
ACAAAACCTCAATTGCCGCTGGTCGACACCACTCATTCCCAGACATCCACATTCTGTACCAAGGATCCAAAAAGCATGGCAAAGAATTGAGGAGCAAAAG
ATCGGACCAGATGGAAGATGCTGATACCAGTTGGCTCGATGTTCTGATCTAGTCAGAGTGTACAGCCTAGTCGCACCCCATAACCCTCTTTATATACAGT
AACTAACCTCTCTATATCGCATAAATCGTGCGGATCCCTGTGGCTCGTCTCTCCGCTCAGTGCGCCAGAAGGCCTGCGCTTCCTCTTTTCCTCGAATTTA
GTTGAGTCTCGGGATACTTTAGAGCCTCTCAAGTATGATCCCGAGTCTCGACAAAGTCTCCAGTTCACTCAAACTCGGTGGAGTGTACTGTGCGCAAATC
CATTGTGATAAACGCACGGCGTTTGTTTGTCAGAGCCAACGAAACGAACTCGACTCCGCGTCTGTTTTCCTAACGGAAGCTGCTTTGGAAAGGCTTTCAA
CGGTAGACAACAGGAGGCAATCACGGTTCGCAGGACGTGTCGCTGGCACTGTACAGCCCGAACGCTGTAATCAGCACGCCAGTGTTCTCCCATGTGGTGG
TGATACACTCGCCCTATGTGTGCCGAGCTCCTCTTTTAAACCCTTTTTAAATAATTATCCCCTTTCAACTAGATAAAATTTGTACTAATCATATTTTACA
GGTTTCAACCTGTAGTGCTGCTTCAAACTGTATATCTGTATCTTTTAATGACGTAGTGCAATCTAATAATGTAAAAACCTACGACCATTTATATATCGCT
CCATGTCAGCCAGCAATGGTCAGTACACTGCTTCTGCGGGTACACATCTCCACGATACACATACAAATTGCAGTGTACACGGAGATGGTCTGTAATGGAG
AGGGAGGGGCCTTTGTAAAGGCGCGCATCTGGCGGCCGATGATGCGCCTCCTCCTACCCCCCCATGCCTGATGGACTGACTGACTGTCTGCGCTCTTTGA
AGCGCGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
TCTCACTTGTGTTTCCAGCGCCGAAAGCAGAAAGCACGCAGCACAGAGCTCCGGAAACAAGCTGGCCGCGCGGAAAGCAACGCCACCGTCCGTCCACTCT
TCCCATTCTCTCCTGCCGCCTGCCTGCCTGCCCCCCGCGGCACTACTGTAGAACGACACG