Description :
From Genome Similarity Track
Location :
contig_38:479920- 482077
Transcript NameFunction/comments
g7162.t1hypothetical protein

Sequence
2157 bases(100 bases per row)
CGCTCAAGGAAGCCCAGCACAATGCGCTGGATGGTGCGCGCCTCGTAGTACATGAAGTCGGACTTCATGGCCTCTAGCTCTTCCATCACACCGTTCTTGA
AGTAGATCAGCGTCTTACCCATTTGGTACTCCAGCGGCGACTTGCGCCCGATCGACGTCATGAAGACGCTGCACGTGCGGCGAACATCCTTGCTGTGCAT
CGATGGCGGGAACATGATAGCGTAGCGCGTGGCCAGCTCCTTCGGAGTCAGACGACTCGGGTACCCGGAGCGTGTGATACGAATGGCTTCGATCACACCG
GCCGAACGCAACTGCTCCACGATCATACGCTTGTTGAATTCCGTCGGACTCTTGTTCGAGTTCGGCTTGATGCAACGCACGTAGTGCGTGTTGGTAGTCT
TGATGTTATCCATCAGCTGGGCCAGCGACGTCTTGAACTGAGAGCCCAAACTCTTTGGGCCCTTCTTGCCGCGTCCGCTTCCGCCTTCCGTCACAGCCTC
GCTGTCCTCAAAGAGCTCCGGCAGCAGCGAGACGCTGCTTAGCTGGATCAGGTCGAGCAAGTCCTTCTGCAACGTATCCCGGTGCTTCTCCATGAAACCC
ACCGTCTCGTACGTGACGGGGCCGGCGTAGTGGTTGACGATAAACTGCGTGCGCTTCACCTTGGGGAAGTCGATACTTTCGTTTGCGTTGCCGTCCTTCT
TCGTCTGGTGATTCGTGCGGATCTTGTTGACCAGGGCCTCTTCCGTGTCACGCGGCTGACGCAGGTGATCGTTCATCAGGGCGATAATACCCATCTTACC
CTCGATCACCTCCACAATGCCTTGGTTGTCCTGGTACTGAATGTGATCCCACTGCAACCCTTCACGGATGTACTCGTCCTCGACAGTCTTGAACACATCC
GTAGTGAACTTCTGCTGCAGCTTCTCGTTCGCGTAGTTAATGCAGAACTGCTCGAAGCCGTTGTGCACAAAGTCCTCGAAACCAAAGATATCCAGCACAC
CGATCTGACCGCTGATACGACTCTCGTCCGTGCTGATGGCAGCGTTGATCTTCACCACCATCCAGTCGAACATCTTCGAGTAGATGGTCTTAGCCAAGGC
ATCGCGGTTCTCCGCCGCTTCCACAGGAGCAAGCGGCACCGTCACGCTATCATTGCGCGTGATGACCGTGCGGTTGCACAGCGCTTCCTCGATTCTCGTC
GTGGGAAGACCGAACATCTTGGCAACCTGCGACAGAGCAGAACCGCTCGAAATACTTGAGCCCTCCTCTCCACTCTTGTCGAACGTCACCTCACCCAGCA
GCAACACACCAGCCAAAAGCTTGAAAAGCGTCTTCTGCGCGCGGGCGTCGAGACCAATAATCGACAGCGACTTTTGCGTGCCAGCAAACCACTTACTGTC
GTCCAGACCAGGAATCTGCATCTCGGCAAGCGAACCCGCGTACTGGTACTTGCAATCAGGGTCCAGTCCAAAGTCCTTTAGCTCGCGGCTAGAAAGACCC
GCAAGAAGCTGGTAGAAAATGTGGTAATTGCGCTCGCCCTCTGCAATTGACACCACACGCGACTTCTCCAGCAAATAGGTCTCGCATTTCGCGCCGATCA
GCTTACCACGGTTATCGAACTGCAGCTGCGTAAACTTACCGAAACGCGAACTGTTGTCGTTACGTGTCGTCTTCGCATTACCGAAAGACTCGAGAAGCGG
GTTGACATCGATGACTTTAGCAATGGTCTTGTCCTTGCGACCACCAGCCACACTAGCCAGGTGGTTCATCACAATTTTCGTCGTTTCCGTCTTACCAGCA
CCCGACTCACCACTCACAAGAATACTCTGGTTCATCTCATTGGTTTTCATGTGCTTGTACGCCGCTGTTGAGGTTGAGTACACGTGAGGAGACAGTGAGT
CACGCGGCTTTCGCAGATACTCCTCATGCAGGTGATCGCCATAAAGGTTCTCGATCCACTTGTACGGGTTCAGAGCAATCACGATGTCGTTAGTGTACGT
GTAGGGCTTTGAGGCAGCGAAGCGCTGCTTCAAATTGAATAGGATTGACGGCTCGTTCAAGTAGCGAAGCAAACGCATATCCTCAACGCCCTCCGGGTTG
TCGTGGAGAATGGCAATTGGAAGAGATTCCACTTCAGTCGCCGTCGGTCCGGCAACG