Description :
From Genome Similarity Track
Location :
scaffold_838:4799- 10595
Transcript NameFunction/comments
g10400.t1hypothetical protein
g10401.t1 hypothetical protein PHYSODRAFT_336115

Sequence
5796 bases(100 bases per row)
AGAGAAGTAGTTCCACGCGAGGTCACTCAGACCATAACTGATAGGGAAGGCACTGAGGGTGCTTTAGCTGCGGGCAACTTAGTTCCGCATGGAGCCGCGA
GAGCTCGTGATACCAAAGTAGTGGCATCACCTGGCGTGGGTAGATCAACCCCACGCCATGGTCGTAAGCCAGGGCTGGTAGAATACCACCCTGAAGTAGT
CCATGGGGACTTAGAGAAGGAGCTAGAAGCTCCTGGGTCACGACCGATCGAAGAATAGTATCACATTTTTGACGGCGTGACCGGGCAACGCTGAAGGCAG
GGGCTGTCGAGTTGGCACCGCTGCCGGAGTTATCAGATCTACTGAACCTCGAGGAAGTCGCGATGGAAGACTTCCTGGCCGAGTTGAAGGCTGGAGAGAT
CGCGGAGATGGTGCTCCTAAGGCCGGATCCCACTCCAGAGGAGTTGAACTCCTCCTCTGTGATGGACGAGGACGTCCTGGAGGAGTTCTGGAAGCAGCAT
GCGTCGCACACGGGCTCCGAGATTCTTAAGAATCCAAAGAATCCGTTGTATTTTTTAGTGAAGGAGTTTGAGGACGTGGTGCCGAAAGACCCACCCTCAA
TGCTCCCACCTGGCCGAGGGATCAGGCACGAGATTGATCTCGTGCCGGGCACGAAGTATTGTGTCACGCGTCAATGGCCTCTGCCCTGAAAGCAGAGCGA
CGTCATTGACGCGTTCTTCGCCGCGAAGGCGAAGGTGGGTATGGTGCAGGAGTCGAAGTCCCCGCACTCGACGCCAACCTTCTGCGTTCGCAAGCCGAAT
GGGAAGTGGCGTCTGGTTCACGCTTAAAATAAGCTGGACAGTGCGACTGTGCCAGCCCAGACGCCGATCCCTCATAAGGACGTGTTGTTGAACAACATGG
CCGGCTGCACGCTGTATAGTGCGCTGGATCTGGTAGACGGATACTACCAGATCCTGATGCGGGAGTGTGATATCCCGCTGACGGCTGTAAGCGCGCCGAG
CGGTATGCTCTGGGAGTGGCTTGTAATGCCACAAGGTCTATCCAACGCACCAGCGACCTTCAATCGCAGTTGTTTGGACCTTTGCGAGCGTTCACGCAGA
CGTAGTTTGACGATATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCTATGGAGGTGCATCGGGAGCACCTCCGTCGATTGTTTGAGGTCATGAG
AGCCAACAAGCTCTGTGCCAACATCGACAAGTGCGTCTTTGCGGCTGAGGAGATAAAGGTCCTCGGCTGCTTTGTCAGCAGCGTCGGGTTCGACCTGACC
CCGACAAGGTCAAGGCCATCGCGGCATGGCCTGTTCCTCGGTCGCAGAAGGACCAGAGGAAGTAGCTTGGTTTAGCCAACTACCTGCACAAGTATAGTGC
TGACTATGCGGGACTCGCAAAGCCTTTGTCGGACCTTCTGAGGAAGGATACCCAGTGGTGCTGGGAGCGCCACCACCAGGATGCGTTCGATAGCATCAAG
GCGAGCTTGCAATGCGCGCCGGTCCTGGCGTTGCCGGACGAGACCAAGTCGTTTAGCGTCGTTTGTGACACTTCCGATTATGCAATTGGCTGTGCGCTAT
TGCAAGAGGACGAGGAGGGACAAGAGCGTGTTGTCTCGTTCCAGTCCAGGCAGCTGAAGGCTGCCGAACGGAACTATCCCGTTCATGACAAGGACCTCGT
GGCAATGAAGTACGCCTTTGTCAAGTCTAGGGTGCATATTCTGGGCACGAAGCCCTTTGTGGTCTATACAGACCACGCATCCTTGCGGACAGCCATCCAC
ACGCCGCATCTATCGCAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCTGGCAAGCTTAACACGCTTGCAG
ACGCGACTATGAGCTGGCTCATATTAGTCGGGTCACGACGGATCTATACGATCGGATACGCTTGGCGTATCGGGACGATGACACCCTCGCCCCCATTGTG
CGGAACTTGTCCGCAGGCACGGATGCCAAGGTCGAGTGGCTTACGCCTCGACAGCGGGCGAGACTTCACCGCTATGAGTGGGACGATGGCCTGCTCCACT
ATAGGGTGGAGCCCGGAGATCCTCCGCGGGTCGTTGTTCCCAACGACGAGGATCTGAAGTATGACATACTTCATGAGGCACACGATGTGCCGTCGAGTGG
CCACTTGGACCGAGAGAAGACCTATCATGGGGTCTCTGATGTTTTGGTGGACCCACATGTACACGTGGGTGGGCAAGTAGATCAAGACATGTGAAACATG
TCAGCGCGTTAAGCCGGCGGGTCACGCGTCGGCTCCGCTACAGAGCCTGCCAGTCCCGCTGGACAGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGC
CTCCCAGCCGATGACCAGAAGAACACCGGCATCGTGGTGCTTGTATGCCGGTTGAGCAAGATGGTGCACCTTGCTCCGGTCTTTGACACCACTACCGGGG
AACAGACTGCGAAGTTGTTCCTTGATAGCGTATTCCGCTATCACGGGTTGCCCGAGACTGTAGTCTCTGATCGCGACCTGCGGTTACCGCTGCGTTTTGG
AAACGCTGTTCCAATTGCTAGAAACACGGTTGACAATGTCAACGGCGGACCATCCGCAGACGGATGGCCAAACCGAGCGCGTCAACTGAGTGGTCGAGGA
CGTGCTGCGCAGTGTTTGCGCAGAGTCGCCGCGCTCTTGGTCAGCGCAGCTGCCTATGGCTGAGTTTGCACTCAACAACGCGGTATACGCGTCGACTGGT
TTCACGCCGTTCTACTTGAACGGGCTACGTAACCCCCAGGTGCCGCTCACACTTGGTGGGGGCACCGGGTCTTCAAGCGTAAGTGGGGGAGAGGCTCGGA
AAGAGCTTTCCTCCCAGGTTTCCGATGTGGAATTAGCCGCGTTGCGGAAGTTGTCGACTTTTGTCGGCAACAGGCTGAATGTGATCAGCCGGGTGCGAGA
TGCAATGGCACTCGCACAGTATAATCAGAAGGAGTACTCAGACCAACATGGAAGAGGAACCTTAAACGTGTTTGATGTGGGTGACTTAGTGCTACTCGAC
ACTAGGAACTTACCGCTTAACACTGTTAGCCCAACGGTGAGCAACAAGTTGAAGCATCGCTTCATTGAACCCTACAAGGTCCTCAGTAGGCACGGCGCTG
CCAACACGAACGACTTGCCTAAGTCGATGACGACCCACCCGACGTTTTATATGGGTCGTCTGAAGCGGTGCCATGACCCTCAGGGTCAGGCAGCCCCTCA
AGAGGAAGAGGGTGGCCGCGAGGAGGAGAGCGATCCTCATCGAAGCGAGGCGGAGCCTCAGGCGCAGTGCACCGTAAAGAGTAGGGAGTCGAGTGACTCT
CAGGGGCAGAGCCGTACCCCCGTGACGGGTACGAGTGTTGTGAGTACACCGAGGGGCCGGCAGCATTGGCCCCATAGCGCGAGTCGACGAAGGACGGGGA
GTACGCATGCGGCTGCGGCTCCCAACGGGACGGCATCGCCCGGAGGTCGAAGACCTCTCGACGCAGGGTCTCGAGATCGTGCGAAGGAGCACTACGGTCT
ACCCGACCATGGAGAGCCTGTATCTCGAGATGCAGGTCTCCCAACTCGCGCAAGGCGCCAGGCTGACCAGCAGCAGCTCAGCCACCCTCCCCAAGACCAA
GGGCAACCTTCAGCGCAAGGACATGCCCTCGGACGAGACAGATCTCCTCCTGTTGCAGAGCAACAACTCGGTCAACAGAGCCAGTCGAAGGCCGCGGAGC
CTCCGGCGTCGAAGACGACTTGAAGGAGTAGTCGGGCGAGGGCCCCTCCAGCCTTGCTCGATCGGAATGGAGAGCTCCACTACCATGTGGAGCGTGTTCT
CTAGGAGCGGTGCCACGGTGGGAAGCGCCAGCTCCGAGAGAAGTGGCGCGGGTACCCTGCATCACAGAGTACTTAGGAGCCGATTGAGCGGCTCCAAGTT
GACCACCCGAAGGCTGTCGCGTACTGGGAATAGACGCGGGGACAGCCTCGTATGTAGTCTGCGGCTTCTTAGCCGCTGTACGGGGTTGGATCACCGGCGA
CCGTGCCCCATACCCGCGCTCGTCACGAGCGCAAGACTGAGACTCGGTTCTCAGTCTCTCCATGTCACGATGGAGCTGACGTTTGCCCACTAGGTGGACA
AACTGGACTCGAAGGTCCCGGAGCTGTAGAATGTGCTCCAGCTGATCTTCGTCGCGGAGTTCTTGGTACTTCTGGGTTGAATGGACTTTCAACCGACCCA
TTGCCAGAAGAGGTCTTCGGCGTCGGTCCACGAGGTGGTGTTCTCAGCGAGAACCCACGGGTAACCCCACGCGGGCTGGAGACCTCCCTTGGTATCAGGC
TTCTTGTGAAGCGTGGCGAATTCCTTGAGAGGAATTCGGTGCTGTGCTAGAAGCACACACCTGGTAATAGATAGGTTGCGTTGGAAGAGAGGTTCTTTTT
GAACCAAGGCCCGCTCATGGGCGCCTTTGGAGGTATGGCCCCCTATGAGATGACGCGGGTCCTTGAGCTGCTCCAGGAATGCGGCAGCTCCCGAGCCTTG
TTCGGGCGGGTAGTAGCACCGCTGGTGCGCAGAGTCCTCGTCGTGTTGATGGGACCCACCGGCGGCCGCTGGTGCGCCGCGGAATGGCTGCTGAGCAGCT
TGATAGAGCTCTTGCTGCTCATCCAGATCGTTGGTGATCTCCCGGTGCTCTTCGACTTGCCCCTCTTCCTCGGAGTCGGGCCCGAAGATGTCTAAAGGCC
TGGATGGCCCGGGCGCGGTCGCGCCCTTCCGTTAGTGTCAGTTTCTTGACAGTCGGCGGCGTAGTGTCGCCGCCACGGCCGCTGGTGTTGATGGGAGACT
TGGCCACGGTGTCCTTGTCTCCATGGGTCTCCTGCATGGTCCGAGCACCTGCTTTAGGCTTGCCCTCGGTGTCGTTGTTGTCGCTCTCGTCGTCAGAGTA
GTCGACAAGAGTCTCCTCTTGTTGGGAGGGACTCCAGGAACCGGAACTATGGTCCATAATAGCGTGCCGAGGATTCGGACGGTTATCAGGCGGTAGGGAC
GGAGACCTACTACGCATTTGGCTAGTTCTAGCGGCCGCAACAGTGTTGCTGGGCGTGCTGATAGCCTTGGAGGCCACATCGGTGGCCTCATGAAGAGCTG
AAGCCTTGCCGCGAGGCTTGGCTGGCATAGAAGTTGGCTTTGCAGCTTCTTCCGTGAAGACGCTTTCGTGTCTGGGTTTGCACCCTTTGCAGACATGTTG
CTGGGCTTCCAAGGAAGCCTGGTACGCGTTGGCAGTGCGCCATCTGCTCTGTGAGAGCAGAAGGCGTACCGCTTAGAGCTGGCGGCAGGTAGATTGATTT
CGACAATAAAGAGAGAAATGTGAGAAGGATTTTCTCTCTTCTCTTATTGGACGAAGTCGTATATAAGTGGGGGAGGATGTAACGGCGTTACATTGAAGAG
TGACATCTGTCACTCTTCCGGAATGAATACATTTGTGTGTCACACATCAGGTGGCCTTGCAGCCACCAATCGCCTTTCATATAGGTTTCACTAGATATAT
CTTTTAGTTTGTATTGCAGGCCAAACTTACAAGCATCTATAATAAAATATCTATAGTGAATATTATTCAGTCTTAAATCTACCTAATCTTAGTTAGTATC
CCCAAAGTCTGGGGACGAGTGAACGGCCGTTCACTAGGAGTTTGTATACTCCAAGCAAGCTTCCTCTGTGTGAAGTGCTGTGTGATCCCCGTCACA