Description :
From Genome Similarity Track
Location :
contig_9:479881- 481461
Transcript NameFunction/comments
g2661.t1POM75133.1 Transmembrane protein [Phytophthora palmivora var. palmivora

Sequence
1580 bases(100 bases per row)
ACCTCGAAGGCGGCGCTCTGCGTGAAGGTGGAACTCCCAGCCTGACGGACAGGGACAGCATTGGCCTGCTTTTCCAGTACGCCGCCGTTGGAATCAACTA
CGGCCTGCTGCCGGCCACCGTGTACCCGTTCCTGCAGCAGTACCTGAACGCTACGGGCTCGCAGGTCACCACGGCTTCGACTCTTGTTATCCTGCCGTGG
AGTTTCAAGGTCTTTTACGGCATCCTGTCGGACTGCGTGCCGATCTTCGGCTACCGTCGTAAGATCTGGATGCTCATCGGTTGGGGCATGTGTCTTATCA
TGCTTATCGTGATGGCGGCCTCTCCGGCTGGCAACCCGTACTACACGGTTCCGTCAGACCGTGACATTGATCCCGCCGATTACACGCCTGAGATCGAGGC
TCGCATCAACTACGACGCGGGTAACCAGGCCGGCAAGTACGTCATGCTCATGTTCTTTGCCGCTATCGGATACGTCCTGGCGGATGTCTGCGCCGACAGT
ATCGTGGTCGACTACGCGCAGCGTGAGCCCATTGAGCAGCGTGGCAAGACCCAGTCGGCCATTTACGCGGTGCGCACAGTGTTCGTCATCCTTGGCCAGC
TTCTGGTCGGTTTCTGCTTCAATGGTGAAGAGTACGGAGGTCAGTTCAACTTCTCCTTGAACTTCCCCGAGTTGATGTCCATTGTGGCGGTCATCACTGC
ACCGATCATCCCCATCACGTGGTTCTTTATCAAGGAAGAGAAGGCGGAGAGGGTTCCGTTCGGCGTGTACATGAATGAGTTGTGGAAGCTCATTCAGAAG
CGTGCGGTCTACCAGGTCGTCTTCTACCAGTTCTTCCAGAACGTTTTCTCCAGCATCTCGTACACGGCCAGTTCTCCCGTTCAATCGTACATGGTGGGCG
TGACCCCGATCAACAACACCATCAGTGAGATTTTCAGCAACGTGCTCTTCATGGCTGGCATCATGGCCACTTCCAAATGGGGACTGCACTGGAGCTGGCG
CAAGATGATCCTCTTCACGGGTATTTTCGTGATCATCGTGGACGGCTTCACGACCTTCTTGACGCTCTGGGACGTGTTCCGCAGCCAGTGGTTCTGGCTC
GGTCTGCCCATGGCTGTGCAGCTCCCGTACGGCGTCGGGTGGATGATTGGCAACTTCGTCATCGTCGAGCTGTCTGGAGTCGGAAACGAAGGCGCCATCT
ACGGTCTCATCACTATGGTTGGAAACCTGGCGTCTCCGTTCGCCCAGGCCCTAACGCTTGTGATCGACCAGCCATTCAACCTGACTACGGAGCGTATCCA
GGCCGACGACAACTCGATCCGTACGGACCTCACGTACGCAGTGCTGATCATGTACGGCATGACGATCTTCTCGTGGTCGTTCCTGATGTTCCTGCCGCGT
CAGAAGGAGGAGACGCAGGAGCTCCTGCGCACGGGTGGCAGCAGCAAGATTCTGGGTGGTATCACGGTCTTCTATGTCACCTTCGCCTTCATTTGGTCGC
TGATGACCAACATCATGGCCATGTACGAGTCCACCTCGTGCCTTGTCATCGCTGGCGGCAAGGGCTGCTAAGTGTCATTC