Description :
From Genome Similarity Track
Location :
Scaffold_2160:4798- 5826
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2160-snap-gene-0.2PERQ amino acid-rich with GYF domain-containing protein 2

Sequence
1028 bases(100 bases per row)
TGCGTGAGATTCTGCTGGAAGAAGAACGCCTGGCAGCGGAGCGTGCCAAGCGCGCTGAAGCGGTGCCCGCTAACTCCCACTGGATGAACGTCGTTGCCGG
CACTGCCTCGACCCCTGCAGCTGCGCCAAAGGTGTCTCGGCTTGGCCCGGTGCCGGCATCGGTCCTGAAGAGTACGACCCGCCAAAGCCGAACATCTGCA
TCTGGTGATGCTGTCGCTGTCGCCCAGCGCAAATCGGCGACTGCACCAAGCAATGTGGAAAGCGATGCCTCGTTCTGGAACTTTGGTGCGGCGGCCGCAT
CGAAGTCCAGTGACGCTCCTTCGTCAACCTCTGGTACCTCCAATTTCGGCTCGGGCAACATTCCGTCCGATTTCATGGGCTGGTGCGCGAAGCAGGTGAA
GGCCATCAATGGCAGTGACGATCTCACGCTTGTCGAATATTGCGCGACGCTTGAGGATCCAGGTGAGATCCGTGAATACCTCGCGGCGTACTTGGGCTCG
ACCCCTCGTGTCTCGGCATTTGCGACCGAATTCATCCAGCGCAAGAAGAGTATGCCAACCCCATCAAAAAAGGCTGCCGCTGTTGATGCCGTGTTCGGTG
GCGAGACGACCGACGTGAACGGTGGCAAGAAGGGCAAGCGCCGCACCAAGGGCCAGAAGATTGACCCGTCTTTGCTTAACTACTCAGTTGGCAGTTAAGT
TCGGCGACACGAAAGTCAACGGCTTGTGGTCAAGTGCCACAGGATCCGTCTGCTGCGAACGCTTGGCGGTTGTGAGCCGATCGGTAGCTCCCCTGTCCGT
GATAGACACGCCCGCCCGCCCGAACGGACCAGTCTTTTTCGATGGAAGAGCCGTCGTTGAGCGATCGCAGACATATCCACCCCCTCTAGTGATAGCAGTA
GTTCCTAGGTTTTCTGCAGCAACAATCTGAAAAAGGTGCCTGCGATGGGAAGTCTTGTCGCTCCACTTCAACTTGGTTCACTGGTGATTAGCCTCAGTTG
GTTTCTCTGTAGCCAGGCTTGAGGAAGC