Description :
From Genome Similarity Track
Location :
Scaffold_52:47971- 49737
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_52-snap-gene-0.26Myosin

Sequence
1766 bases(100 bases per row)
ACCAGTCAATTCTCGTGAGTGGCGAAAGTGGCAGTGGCAAAACCGAATCGACCAAGTTCTTGATGGAGTACTTGGCGCAGGCCGGCGACAACCAAGCGCA
GTCGTTGACAATGTCGAAAATGGGCCAAGCCGGCATCGCTGCCAAGGTACTGCAGACGAATACACTGCTGGAATCATTTGGCAACGCGCGTACATTGCGG
AATGACAACTCGAGTCGCTTTGGCAAGTTTATTAAGCTCCACTTCACATCCGGCGGCCGATTGACAGGTGCGAGCATTCAGACATATTTGCTCGAGAAAG
TGCGGCTCGTGTCGCAATCGATCGGCGAGCGCAATTATCACATTTTCTATGAGATGACGAGTGGCGCGTCCCCTTCAGCAAGAGAGCGATGGCAACTGGA
TCCACCGCATGGCGAGGTGATGGCCACGGGTGATGTTGGTGATGTCCCCGAGGCTGCGCGACAGTTCCTGCACTACCGATATCTGAATCAAAGTCAGTGC
TTCAAGAGACGAGACGGAACGGAAGATAAAGAGATGTTCCAGCGCGTCGTGGACGCTATGCAGGTGGTCGGTTTCACAGATTTCGAGCGTTCGGGTATTT
TCGACCTGCTTGCAGCGTTATTACATATCGGTAACCTCACATTCGAGCACGACGAAAACAGCGATCGCCAGTCGACCGATCCGACAAACTCATCCACAGA
TTTAGCGCCAAACTGTATATGGTCGCGAGACGCCGCGGCGACGTTGCTGACCGTTGATGCCAATCAGCTGGAGAAAGCACTGAGTGTGCGCAAGATTCGA
GCTGGTACCGATTTCGTGAGCGTCAAGTTATCTGCAGAACAGGCCAACAACGCTCGTGATGCACTCGCGAAAGCTCTGTACGGACGATTGTTCGACTGGA
TGGTCGGCAAGGTGAACGAATTCCTGAAGATGGACGACTCACAGAAAGCCAAGGGAGGGATGCATTTTATTGGCATTTTGGACATTTTCGGTTTTGAAGT
GTTTCCAAAGAACTCGTTTGAGCAGCTTTGTATCAACTTTGCAAATGAGACGCTGCAGCAGCAGTTCAACGATTATGTCTTCAAGATGGAGCAGCTGGAG
TACGAGTCGCAGGGTGTTGATTGGAAATACGTCGAATTTCTCGATAACCAGGATTGTGTGAACCTCATCTCCCAGCGACCGACTGGTATTTTGCCGCTTG
TCGATGAGGAGTGCCTCATTCCCAAGGGAAACGACACGACATTTGCGTCCAAGCTCTATCGCGCATGGGAAGGTCACCCGCGCTTCTCCGCGTCCCGAAT
GCAGAAAGCAAGTGGCAACTTTACCATTGTCCACTACGCCGGCAATGTTGAATACTCGTCTGTCGGGTTCCTGGAAAAGAACAAAGATGTTTTGCACCAA
GAAGCCGTGGATCTACTGGTCTATTCACCTCAGGAAGGCAGTTTCACGCGAACTCTGTGTGAAGGAATCGGTTTCCGGGATCGTGCCAAGTCGTCTCCAC
GACAACGTGCCAATGCCAGCAAGCAACGTGGTGCAAGCGTTGGTTTGCAATTCAAGGAGCAGTTGACGGCGTTGCTTGAGACTCTTCACACAACGAGTCC
ACATTACGTGAGATGCCTGAAGCCAAATGACACACACATAGCGGGTAAGTATGACCGTGAGCGCGTTCTTAATCAGCTTCGGTGCAACGGTGTGATGGAA
GCAGTCCGAGTTGCTCGTGCTGGGTTCCCCATTCGTATTCCTCATGACGAATTTGTTGGACGCTAC