Description :
From Genome Similarity Track
Location :
Scaffold_97:47968- 49080
Transcript NameFunction/comments
Phyci_237112Hypothetical protein

Sequence
1112 bases(100 bases per row)
AAATTCGTCACGGCTCGCCCGATGCATGCGGGTATCGACTACCAGCGCTACCTTTCAGAGAAGGAGGCTACCCACACTGAGTGGAAAGCTTGGGAAAAGA
AGCACGGCGCCAAAGCTATAGAACTCGGACTTATGCCCACGTCGGAGGAGCGCAGCAGCGACGACTACGAGGAAGATATGCGCCAGCGCATCTTCCTGAG
CAAACAGGACGTCAAACAAGCTCAGGCCGCCAACCCGAACGCCCATTTCTCCATCGACGTCGTGTACTCCATCATGACGAAGGAGGAGTTCGCCGCTATA
ATCATGAACTCGTTCGCAATGGGTAACACCACAACTCGCGGCGTCCCAAGCGATGAAAACAAGGCTAAACCGGTGACTGCCATGTCGGCGACGTCGGCGA
CACGTAAACCGCATCACGTCTCCTCGACGGGGTCTCCTCAGAAGCATTCGGTCGCACGAAGGACCACCGCCCTCGCCCATGCATCCAACGAGGCAGCAAC
CGCCGGCACGGTCGACTGGACCAAGTCGGCGTGCATGTCGCCCATCCAGAACCAGGGCCAGTGCGGAGACTGCTGGGCTTTCGCATCAGCCGCAGCCATC
GAGTCGGCGCAGTCCATCGCCGGCGGCCGAAGGTCGTTGCACAAGTACTCGGAGCAGCAGCTCGTGAGCTGCAACAAGCAGAACCGCGGCTGCAACGGCG
GCGCGCCGCAGTACGCCTTCGATTACATCCTCAAGAATGGCGTCTGCAGTGAGGCCGCGTTCCCGTACGCGTCGGGGCAGGGCCGCATCCCGTCGTGCGG
CAGGTGCACCAGGACCCAGCCGGGCATCAAGGGCTACACCGTGCTGAACGTGGGGGACGAGGCCGGTCTCATCAAGGCCATCAACCAGCGACCGACGGTC
GTGACGGTGGCCGCCGGCAATGTAGCGTGGAAGCAGTACACAGGTGGCGTGCTGTCGGGCTGCGACACCAGCGCACTGGACCACGTCGTGGTGGCGGTGG
GCTACGACGCCACGAGTCTCAAGATCCGCAACTCATGGGGCGCCAACTGGGGCGAGCGCGGCCACATCCGCCTCAAGCGCCGGTCGTCGGGCTCGGGCAC
CTGCAGCGTCCT