Description :
From Genome Similarity Track
Location :
contig_135:47963- 49121
Transcript NameFunction/comments
g14194.t1RAW29060.1 Midasin [Phytophthora cactorum

Sequence
1158 bases(100 bases per row)
TTCAGCACGTCAACTGCCACAGGCAGCCTTTGCGCTTCATCACCTTCTGGAGACTGTTGGCCACGGGAAACAACCGGTGAAACACCATACACGCGCTTGG
ACGGTCGCGCAAAAGCCACGATGGCAGCGTCGCCACCAGCATCTTCACTAGCATTCACAACGCGGTGGGGGATCGCAGGCGCACCGAGCGACTGCATCAA
CCCAGCACTTTCGGTGAACGATTTCTGGATTGCATCGCATCGCTCAAAGATTCGCTGGAACTGCTGACGGACTTGCACCACCACTGACGAGGTCTCAGAC
GACTGCTGTAGAATCTGTAGCACAGAAATCTCAAGCTCACGCAGGGACCGGCGCAGTGGGACGACTGACGTTTGCTGGAACACCTGCCACTCGCTTGCTG
TCTTCGGGTCAATCGCAGCTCCTTCGGAGAGATAGTTCTTCTTGAAGTCCTTCATCAGTTTAAGTGTGGCTAGTCCATCCACGAGCTTTTCATGGCTGAG
TGACGTGGCGTGAAGAATCTGGCGTTGCTGCAGCATCGTGAACAACATGTTCTCGGCGTATCCACTCATGCGCTCGGTTTCGCTGGACGACAAGTCGTGC
GAAAAACTTGTTACTGCGCTGTACCGCAACGATGCAAGCTGGCCTAGGAAACGGTAGTAGTATCCGTCGGCCCGCTGCCATAACCACATGGGGGAGTTTT
TCGTCAGCGTATCCTCCGATGCTTCAACCTGCTGCACACCTCCAGCAGCCTGTTTAGCCTTCTTTTTGCTTCGCTTTTTCTTACCCTTCAGACCGCGGGC
ACTGGACGCAGTCAACAAACCTTCAGAATCCACAACATCTTCTAGTTGATCAACGTGAAGACAGTTTTCCACGTCAGGCACGTCCAGCTCAAACAGTTGT
TGGATCTGCTGTTGCTCGGTAGGCAATTGCAGTCGGTGGTACACCATTCCCTGGGCCTTCAGCTCAGCCAACAGGTCAATAAGTGCCTTCTTCTTTGCGC
CCTTGGGCAATCCGGTAGCTTTCTGTAGTCTGAACATCCGGTAGAAAATGGCTTCACATAGATCCTCGCATACATCGCGCACCTGCTGACGGCATTCCAC
TTGCTCATGCGACAAAATGTGCTTCTGAGTGTACTTGGTGATACGCTTCGAGAGTGTC