Description :
From Genome Similarity Track
Location :
Scaffold_703:4796- 6714
Sequence
1918 bases(100 bases per row)
AGTACATGTTGGCACATTTAATGGAATCATTGTTCTATAAAAAGTAAAGGCTACACAGAGCCTGAAAAACACTTACAGGAAAAGGGGCTGAACAGAGGGT
ATGGCAGGTGCAAGGTGGCATTAACGACGGAGTCTGTGACAGCTCACCCAGATCACGTGCTAGATGGATTACAAGACAGGCCTCATTAACTCCAAGACGC
CACTACCGAGACAAGACGCATCTGGTTAGATATTACCGGCGATACCGTCAAAGTACACGGAGGAAAGGATAAACAACCACAGAGTTCTTTAAACGGATCT
CGTGTAAGTTTGGGGACAACGTTGTTTCTACCCCACGTCTTACACAAAGGAACGACACTTAGTTCGCACTGCCAATGAAAAAGCAAACAAATTAGTGGAC
GCCTGGAGCTCCGTACTATACGTATTTTACGCTTTATCACCAGCGTACACTGTAGCTAACTTGATGGATCCTGGCCTTACGGAAAATTTAGAATGTATTG
GGACCACACTATTTGTCCACGCTATAAACAGTCAGATCGAATTTTGAGATATTGAAGAAGGAGGGAAACGATAATGGGAAGGATCGCCTCGGTATCGATT
GGTACCTCTAATATGTGGACATACTAATTCTTCTATTACCCTAGCTTTTTCGTGATGTAGTACGGAGACAAAGCTTTTCCAGCACCCAACCTCAACATAT
ACGTATTATGTCTCAAGAAGACGGGATAGCATTCCTTTGAACCACCTCCCTCTTCCTCTACTCAACTTAGATTACAAGCTATTCAATAAATATTGCAAGC
CAGCTTCGGGGTAATCCCCCAGTACGGATTTATTCGCATCATCACGGATTTGTGCCTAACTGGCCAATCCATACATTATTAGACAACTTCTTCTCAGCAC
AGAAAATGGCCACGCATACGCATGAACGTATGAATGCGGTTGCTACTTGATTGAAATCTGCTAAGACGCACGACGCGCTGGATTGGGACCATCTCTTCGC
AGTTCTTCGTAAAGACCGGTAATCTCACCACCTAGTGAGCGTCATTGAGAAGATACATACGGGGACTTCCAAACGCTTTATAGCAAATGGGGCGGTCGCG
ACAAGTACCTATTACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGAAAAGCTTTGTCTCCGTACTACATCACGAAAAAGC
TAGGGTAATAGAAGAATTAGTATGTCCACATATTAGAGGTACCAATNNNNNNNNNNATCCCCGAGCCGCACCAAACCGCGTGACGATGTACAGAACTAGA
TCTATCTCACCCGTATGCTTAACATAGTTGGCCGNNNNNNNNNNCACCTGGAAGCACTTTGTAGTCCTTCCAGCGACCACAACCACCTCATCTGACATGA
ACATGTTGGATGAGGAGGAGAGTCTTCACGCCACGCGTGAAGACTATACCCATTTGAGTGACATCGAATGGAGTGNNNNNNNNNNCGAAACCCAAGCAGG
GTAAGCGTAATGTGCACACTTACACTGAACACATACGACTCCTCGCGAGTAGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCGTATGTGTCGTCCCGCCCACAGCAGCATTGAATTGCTGC
TGTCTCAACAGCTCTGTC