Description :
From Genome Similarity Track
Location :
contig_11:479511- 480950
Sequence
1439 bases(100 bases per row)
GATGCTTTTGGCTTGCTCGGTGTGCCGATGCTGCTGACATTGCTGACGTGCATTGTGTGGACAACGTGGCTCATCGTCGTGGCGTTGGAGCCAAACCAAA
CTGCGAACTGGCTGATGGGGACTAGCACCTACGACAATGGTCAGTTTTGGCTGATCAGCGACAAAACGCCCAGCATAGCTGTTGCTGGTGCAATAGGCCT
TGCAATCGTTGATTTGTGCTACGTGTACGCTGCCGTGAAGATGCTGCGGTGGTGAGGACGACTTGATGAGGTTGCTTCAGCCTTTCAGCTCACCACGGAC
GTAACTGAAACACAAGAATCTGTAAACTGCGCTCGAGTTTGGTGGAGACTTAGTGTAGCAGCATATCACGGAAGTCGTCACTTCTACAAGGAGCTTACAT
CATTTTCAGGGAACAAGCGCAAGTTTTGGGTGAGCTGGGGGCCCACTTCACCACAGTTAAACCACGTTCTGTGTTAACGCTTCTCCTTGTTGTGCCGGCA
GAACGTCAGCTCGAAGGCATTTAATTTGACGATGCAGGTGTTTGTCCTTCTTGACTTGCTGAAGAGCGGTAGCCCTGCGGTGCTTGTTCTGGGGTATGCG
ACTTTAGTAGCGATCAACTCGCTTTCATGCGCCGTAAACATCTTCTACGGCAAATTATCTGCTGTAGCGGAGGTCCTCGTCAGTTCCATGTACGACCGCT
CTGCCCTTTCACCTTTTTTTCTGCTACTGACCTCCGTCCTGGTTGCTTTCTCTGCGTTGCAAATATTGCTACAGCTTCGACTGGTTTGCAACCGTAGCGC
ATCCCATAGTGGTTTTGGCGTATTGCTATTCGACATTTAATTTCGACCACGCCACCTTCAGAACGTTCCTTGAGAAGCTGCCACCAAGCAGCTTCGAACA
CCAAGCGAGGACATTCGCTGATCCATCGCAAGTCGCACTTTTCCGGCTCAACTTTGGCTCTCTTCGCACTCGCTCTGTATTGGATTTGGCGCTGCGAGTT
GGTATGAACCTGTCGTTTTGCTACCGCATCAAAAGGATCGGAGACATCCTTGTCACGTCTCAACACAATGCACTTTCAAGGGTCCAGAAGCCTGTACCGA
GAGCGCTTTCTGCTGTCTTCATCGCTTTCAGCATTGCAGTATGGATATTGACGTTCCAAGCGATTGCCGAATCTCGTGCCAAATGCTCACAGCACCCTAA
GTGTGTTGTGTACTCGTACCGTCGCGGCTACAGTGACGGAATGTGTCCTTGCCAAATCTTCATCAGCGTCGACCCTGCACCGCAAACTTACGAAGAGTGG
ATTTCTCCTTTTGATGTCTACAACGAGGTCAAGGAGTTGGCAGCTTCTGGAGAACTGAGATCGATCCAAATTGTAAACCGCCAACTGCTCGAATTACCAA
CAGCTCTTCGCTCGTGTCGATATCTTGAGTTCATGTACG