Description :
From Genome Similarity Track
Location :
Scaffold_1960:4795- 5906
Transcript NameFunction/comments
Phyta_totarag13928hypothetical protein PHYSODRAFT_494903

Sequence
1111 bases(100 bases per row)
GCTGGCATATACCCGAGGTCGACTGGTTGGCGGAGATCCACTCGGGCATGCACGTCACAAAGCGAGTGACAAGCGTTTGTAGAGTCATGAAACCCGTCAC
GGTATACACCGAGTAGTAGTCCGTCACGATGTCCTTCTGGAATGAGTCTACGTCAGAAAGAGAGCCGTCCGTGGTCGGCACACGACCCACGGAATCGATA
TCGTCACCCTGTGTCGAGTTTAGACGCAGCGAGTACTCAATGGAAGTAAACGTTCCAATGTCATCTCCCGACGGAGCCGAGTCGAACACAATCGCGGCAA
AGATTTTCGGGTTGTCGAGATTGTCACCGTAGGTATCACTCTTCACATACTCCGTCAACGCATCGTTCGAGTCGAAGAACTGGACGCTCTCCTTGAACGA
CGGGGTCGTCAGCGCCTCactcgacgagttcaacagATCCATTCGCGGGTACCACGTGTCCATCGCCTCGGTGAAGTAGTTGCGCGTGAAGGCGTTGTCC
GGAGCGATGCCGATCTTGTACGGCACAACCTTGCCGTCGCACTCGGCCGGAACGCTGTagggcgacgacgtgtcCGTGTCAACCAGACCGCCAGCCATCA
CTCCAGCCCGACAGGCAGCCAGGTCGGAGGCTGACAGCTCTTCCAGTCGCAGGCCGTCGTCGATGGACTGACGtccgagcttgagcatgaGTCCGGTCAT
GGTGGActcgtgcagcgcgaacTTGGGCAGGTCGGTGTCCACCCACTCGATGCTTTGTCCCGTCGGCTGGAAGAGGTTGTAGCTGGTGCCGGCGGAGTTG
TCAGCGTCGTCACTCCAGCCTGCCGGGACGTCGACCGTTGTTGTGAGTAACTTGAGGATTCCGAGCaacaggatgaagaaggtgggCACGAGGATCTCGC
ACGCAGTCGCGACAGGCTGGCGGTTCTTGACGAGCCAGTTTTTCCACAGCAGGGCTCGCATGAACGTCCATGACGTGCGATGCTTTGCCAAGTTCTCGCT
GGAGGTCTTCATGAGCTTCTCCTGGAGAGTCATTGGTGTCGActcgcttgagcttcttcgtaGAGTTTTTCGTGATGGATGGAGgttgttgccgttgaag
tGTGCACTTGG