Description :
From Genome Similarity Track
Location :
contig_15:479457- 480633
Transcript NameFunction/comments
g3444.t1Sulfate Permease (SulP) Family

Sequence
1176 bases(100 bases per row)
CAACTACTGCCGTCGCTTCCGCCTCAGCCCGTAGTTGCGCCTGCGAGTGCTCCTACTGATGGCAATCCCCAAGAACGATCAGAGGAGGAATTGGGCCCAC
CCAACCTGCATTTTTTTCGCCAGCGCCCACTTCAGGTTATCACAAAGGACGGAGCTCCGTCTGTAGAAAAACTATTCTGTGTCTGGAACCCAAAGGTATC
TAAGAAGAAGAACGTGAAGCAAGTGGAGACCGAGCGTGATGAACCCAATCCATCACAACTTTCTTCATCTGCGTTGGCGTCAAGAAAACGCAAGCGTACC
GAGGGCACACCGAACATATCGAAGTCCAATGATGAAGATCAATCCAGCACGAGCACCAGTGCGATTTTTCAAGGAGCTAGAATCCTTGGTCGCTTAGTGG
AAGCTGAAATCGCTACACTCCTGTTCTGCCGGGGGAGAAAACTAACGGAGCTGGTATTGATGAATCTCCACTCGATTCTGAAGGCCGATGCTAGCACTCA
GAATCTGATTCATCGGGTTTGTTCCTATCGTGGTGGGTATACTCTGGAATCCAGGCGGCGGATTGAGCAGCGACTGTTTAGTGGAGATTTGCTGGGTGTT
GTGGCAACGAACGCTTTGGAGTTGGGTATTGATATCGGCGAGTTGGACTGTACTATACATCTTGGACTCCCATCGAGCGTCGCGTCCTTGTGGCAACAAG
CCGGTCGTGCAGGTCGCCGCCAGCAGCAATCTAAGCAAAAGCAGTCTGTAGCGATCATTGTGTGCTTTGATGCACCACTGGACCAACACTTTGCGCAGAA
GGAACACGCGCTGGAGCTTTTCCAACTGGAGCCAGAAGCCGTGAGTCTGAACCCGATGAATCACTGTGTCCTCGGTCAACACTTGCTGTGCGCTGCCCGT
GAGTCAGCGCTTTATTCTCCACAGTCTGGAACGGCTTACATTGACTCGTACGTATTCGGGAGACTGTCTGAAAGCCAACACGACGGAGGCCACATGAGCG
TTGAAGGCGGTGGACAAACGGTGGTGTCTGAGGTCGACGAGATACTCCAGCCTCTTGTGAAAGAGCGCAAGTTGATGCAGTGTACAGAGGCTGATGGACG
CATCAATTATCGAATTCATTCGTGTATGCCGAAAAAGTTTCGTGCTGTGAGCTTGCGCAGCATCTGCGATGAAAAC