Description :
From Genome Similarity Track
Location :
Scaffold_235:47945- 50333
Transcript NameFunction/comments
Hyaar_Emoy2813007glyoxalase/bleomycin resistance protein/dioxygenase
Hyaar_Emoy2813008hypothetical protein

Sequence
2388 bases(100 bases per row)
TCACCACACTTCTGGCATGTCAATCTCTTCCAGCACCCTCGATCATCGTGTCTAGTAGATTCAAAATGGATGCACTCCTTCGATCGCCCACCACGATCGT
CTCCATCTCTTTCACCAGTGTTCTTCTGCCAGGTGCGGTGATCCTTGTCCTGCTTTTCTTGGTCGGATGTAGTTGTTATACAAACTCGACGACGGTCCAC
TTTCTTCTTCGGATCCATTTGACTTCGATTCCGATCCGCTGCTTTCGACTTTCTCGCGGATCACTCGTACCGCCCGAGCTGTCTTTGACGACATCGGGCT
TGAAGACATGGTCGTTCACTGATGGAATTTGTTCGATCCCATCAACGCTTTCATCTGGCGATTCACCATCCGTTGGCACGCACGTAAAGTTTCCTCTACC
TTGTCAACACCCATCAATCGCAGTACGGCCAGCTGTTTTGCCAGATCACGATCATCCAGCGTAGCAATGAAGTGCTCCACATGTTCGCGACGTGTGGCCG
AGGTAGCCAATCTTTCTTCTTTGATTGCGATCTTGACGAGTTTTGCAGCAACATTATGGCGATGCAGGTACTCCAGCGGGGTTCATTTGATCGCTTCCGT
GCGAGATAATATTGCCTAGCCACAGACACCCCATCCCCTCCATACTGAATCATGAAACAATTCAGCAATTGTTTCCACTTGTGCCGTGTAGATCGACTCA
GTTGGTTGTACCAGTTTCGTGCTGGCCCTATGAACAGGTCGCCGAAAACCAAAACAATTTTCTTCGTCTGGCGCCTGATCGCGCAGGAACGCCTATTTTA
CCTCGCTGATCCAGCTTCTAGCCCGATCCTTATCTCTTTCTTTGCCACTGAATTCTTTCAGCTCCGTCATCGCTTACACGCGAATATGTTGGAGAATTGC
ACCACCATTCTGCAATGTTTCTGTGGTGGCTACCATCGCACGTCTCCGCTCTTCTTGCCCTGATTCATCGGGATCGGCATCTTCAGGATCGAAAATGTCC
GATTGCATCTCAGTCGATCGGACCGATTCCATTTCGACATCTGGGGTGTATGCTTTGATCCTTTGGCTAGGGTAGATCACTTGATACGCTTGTTCTCGTT
GGTTTTGTTGAAAACATTCCCAGGCTTCCTCGAGGTACGCCTGCAGGTGTCCTTGCGTAAACAAATTTGTCTCTTCCTTAACACGTGCGGTAGTCGATCG
TGGTTTGATCTTGATCGTCTCAACTCTATCGCGCAGATGTGCCGCCCCACTTGGACCTAGAGACATCCGCTGAACATCGATCAAATCATCCGGCTCGATT
TCAGATTCAGCTGACGCGTGCTGCGACGATCCGGTGTGGTATCCCCTCGGGGTGTCTACAATAGCTGCTTCCGCTTGATCCGTAGGATCACACTTATCCG
TCAGGGGAAATAACTTATCATATATCGATCGATACGCGTGGGTCACTCGACCTTGTTCTGACTCCAGCAATTTGTTCGCGTCGAACACTCCGGCAAAAAC
AATTAGCGTCATGTAGCAGTCGTGTGATACCGTTGATCTCGTTCAGCGTGTTAGACACTATTGCCGGTGGGGGTATCGGACCCTTAATCCCTCGATCAGC
TTGGGCTTCATTCCCCGGAGCACTGGGTCGCTTGATAGCAGATTATTGAGTGTATTCCACTGATATCCCTTCGCTAACTGATTCAGCTGCCAGCCTTCCA
TCTTCATATTGTCGTCCACGAACTTTATCGGTCGATTGATCGAATTCAAGCTGCGATCGTGCTGATCCGATCTGGGCGCTTCTTTCTTCACTCGTGCTGT
CTTCACGTTCTTCGTCTTTGACTATGCTTGAGTGGTCTTGGGTGATAACTGCTCGGTTTTATCCGGATGGTTTTCACCCAGCAGATCGTGCTTTGCGGCG
CGATCCCCGAAGGGACCTCAGGGGGGTCGAGATTTCTCTTCCAGATCGATCGATCGATCTTCCTCTTTCATATTCTTGTCATCAGAGCCCATCCCAAAAC
TTCGATAATCTGGGGATCCTTTAAAATTACGCGTCGGCGGCGATCCCTCTGCCTCTGACGCTTCCATATTAAGTTCTGTCTTGATTTCACCTCTTCACTC
CGGGACTCACGGTAAAATCCCGAGTCACCAGAAGATCCGGGCATGCGCACCATTGTGGTGGAGTGGCGATCGCTCATTTTAAGAGGCGATGCCAACTCTC
CACTGGTGCCCAGACGACCGACTAACGGACGGGGTACTCCGATACCGTGTAGATGTATTCCTTCCTCACATTGTGTACCCGTCCGTAGGGCGGGTTACAC
TCTTCTCGGTGGACTCGTGTCGAGGGAAAACTTGGCCGTGTTGGGAATGGGGTTTGTGATCGCGCGGAAACCTTCACACGATCACGGG