Description :
From Genome Similarity Track
Location :
Scaffold_1073:4794- 6237
Sequence
1443 bases(100 bases per row)
CTTCCGGATCGGAGGAGGAATGCTCTCCAAAGCGGAAACAGGTGGAGCCGGACTTCCAGCCTTCGCCGATCACGGATCAAGCGTGTGCACCGATAGATGA
CGCGAAGCCGCAAGATGATCGTGCTGGCGATCCAGAGGGGAAGCCAGAACATGTGGATTCCGGTGGTAAAGCAGCTGAGAAGGGCGAAATCGTGCCCCCT
CATTTGCCATCGGCCGATCAGGTCGACGGTTGTGCCGTCGAACCAGATCTTGGGGGCGGGAGTACCGATCGGACACACCCTGTTGCGGTCTTAGCTGTGG
AAGAGTCGAGATCAAGTGATGATACAGCAGTCGACGGTGTTCCTGCATCTGAACGACTGCCGCAAGTGGCTGAAGACTCATCGATCGTTGGAGGTGATCA
GCTGGAAATGGAGGCCAAACCCACTTCAAATCGGGACGACCTCATTGCATCCGAACCAGATCGAGATGTTGGCGCTGATGATCAGGTCCATTACCACGAG
GGCCGGAATCTGTCAGCAGAAGATGTCGAAGGTGAATTAGCTGTGCTTCCTGAAATTGTGATCTCGACGACGGATGAGGTAAAGATCGATGATATCAAGG
TGGGAGATCTGGAGTTCAACACCCTGGAGGAGATCGATCGGCTGCGAAAGAAGATCTGGCACAGGAATCACCTGCTGATCGGCAAGGGCAATGCACTTCC
CCCAGCAGCCCAGGGCGTCACCTGCGACATCGACGTGGGCGACGCGAAGCCGATCACTCAACGTGTCCGGAAAGTTGCCCCTCAGTTCGTGGAGAAGGTG
TCCGAGCTGATCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCATGGGCCTCGCCGATCGTCGTGATCACCAAGAAGAACGGCGTGG
ATATCCGACTCTGCATAGATTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTATATCCGATGCCCTTGATCAACGATTTGCTGGAGGATCTGGATAA
GGTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGATCGAGCTCGTGCGATCTCGGCCTTTATCACCCACATGGGT
CTGTTCGAGTGGAACCGGATGCCGTTCGGCTTGAAGAACGCTCCTCAGATCTACCAGCGACTTCTGGACGACGCGTTTTATGGGTTCACCAGGATCCCGC
GATCGTCAGACTGTGAAGTCACTACGGACTTGATCGAGTCAGGAGAACCAGAAGATCCGGGGCGTCCATCAGTGCTAGGTCGCAGATTGTACATCGATGA
CATTCTTGTGACGGCCGGATCATGGGATGAGCTGTGCGATCGTGTGGGTCACCTGCTGGACGCTTGTGATAAGTGGAACATCTCGATCAGTGTGGAGAAG
AGCTCTTGGGGGATGCGTAGGTGGACTATCTGGGACATCGTGT