Description :
From Genome Similarity Track
Location :
scaffold_325:4793- 6646
Transcript NameFunction/comments
Pl_106083hypothetical protein PHYSODRAFT_498521

Sequence
1853 bases(100 bases per row)
GAGCCCACCAACTCCACCAAGCCCACCAAGTCCGCCGACTCCACCGACTCCACCGACTCCACCAACTCCACCGAGTCCACCGAGTCCACCAAATCCACCA
ACTCCACCGACTCCACCAACTCCACCGAATCCGTCCATTTCTGCGTTCCCCTTTTGATCACTCTTCGGCGGGGTTGCATCCTCTGGGGTATCTACTGCCA
GTGACACCGCGAACAGAATCGAAACGAAGCTGAAGAAAAACGACTTCATTGTTTGCTCACAGGAAAATTGGGGAGTGAGGCAAGATCGGTTCTCGCAGTT
TGCATGCAGGAGAAGATCAAATTCCGAGAATGGCGCAGACGACTTACGTCATTGCTGAAAATGCAACCCCAGGAAGAATTCTCGGAAATTTGACCAACGA
GTTCCTATAGACTACGAAAATGTTGTTCCACTTTCTTGATCTACAGGCATTCAATTTGTGAATCACAGACGAATGACTCACTCGATGTCAAAACCAATCA
AAGAGTGCGTACCTTTTCATCCCAAGCGGCAACATCAGCCTGTAATTTGGATTCTTCCTGTGCACATTGCTGTTGCAAGCTGAGTTCCCGGCGACGAAGT
TCAAACTCGATGCGTTTTTGTTTTGCTCCGTTAGACTCGTTCAACCGACGAGCGTATTCTTCCCCATGCTACGTCAAGCAAAAGCGAATCAATACAAGTT
GCAAGCAAGCGGGATTTACATACCTTGATACCTTCGGCTAAGATTCGACCCAAGTACTCAGCATCGCGAAATTCTGATGTCATTTCTTTCTCTTGCTTTA
GCAGTGAGTCCTTTTGGCGGCGTAGCTTTGCTTGGGTTTTAACAGTGCCTTTGTTGTTGCGCTGCTGCTCTTGGTATTCAACCTGAAGGTCATCGATCTT
CTTCTTTACATCGCTGACAGATTCGCTGAGGTTTCTGATTTTCGCCTCTTGTTCTTCACGGTCTTTCACCAGAGAATCAATTTCGCCATCCAGCTGGTCC
ACTGTATCCTTTGCCGCCATAATTTGAGCTCCAGTGTCCTCCAGTGTCACATCAAGCTGTATATACAGTCATCATCACTTACTTACCAGCTACTACTATA
GAAAAGGAGGAATACTAACTTGTTTTTGGTCTGCTTCCAGCAACTTGAGTAGATTCTATAGACATCATGGTTTTGTCAACCATGAGATTATGAACAAAAG
AGTTGAACGCATACCTGTTTCTCTTCCAACTTTTTCTGAGCGATCTGAGCAACGTCGCGCTTTGTAGTTAACTCTTCTTGAAGTCGAGTCGTGGTGAAGT
CGCCTTTTTCCCGACTGAAGGTTGCGATTGATGTAGATAGGTCTGAGATGGCATTCTATTATACCACAAGACGTCAGCAGATGTATCAATCTTCAATTGT
GTCAAAAGGTCCTCACCTCGGCAGCAGCTAGTTGCTCGTTACGTGCATTTAACCTCATTAAAATAATGTTAAACAAGTGGTGGATACCTGTTAAGTAAAT
ACAATTGTCCACACCTCTGTTCCAGCTCTTCACGCCTGGAGCTTAAAGCATCGATACTAGACATCGCGTCCTCGTTCGCCATCTGACCTTTTTCAAGCTC
TGTTTATTCATAAGACGTCAGCCGCGTGGTCGGATACGCTGAATAAGCTCAAGAGTCATACCCGATGTGATAAAGGTGATTCGGCGTTTGAGCGAACAAA
TCTCGTTTTTGGTTTTCAGTCGAAACTTTCGGCGCTTGGCCTTCAGCTTGCCTTCAATCTTTCCTGGACATACCAGGCGATAATGTTTGAGCTGTAGAGA
AGTTCTTCTCATAAAAGGAAACGACCACATTGGTACCATTTTCTTTGATGACG