Description :
From Genome Similarity Track
Location :
Scaffold_288:4793- 6546
Transcript NameFunction/comments
Phypl_g6483hypothetical protein
Phypl_g6484hypothetical protein

Sequence
1753 bases(100 bases per row)
GGTATCGAGACGTACTTTTACGATCCGTTCGCGTTCCGTGAAccgaacgagaagctggctTCTCTGCGCGAATTTTGTGCGCGCAACACGCAGACCGtgg
gcgagttgctgctAAGCTTTCTTCGCTACTATGGCTTGCAGTTCGATGCCACGCGCGATGTCGTAAGTGTTCGTCGCTCAGACGCTGACACGGTcaccaa
ggacgagaagcgaCACACTTCTCAGTGGCGCTTTACGACGCGGCTGAGCATCGAAGATCCGTTCGAGGTGGGCTACGACGTAGCTCACGTGCTGAAGGGC
TCTCGTGACAAGTACATTCGCCAGCAGTTCGTGCGCGCGTACGTGCTACTTATGGATGGCGCTATCCGACACCAGGGCAAAATTGAGGGAGCCTCTGGCG
AGGAAGGCAGCCAAACAGAGCAAGAAACGGAGGCTGACAACGAAGCTGTGGAGCGCATCATGTCGATCGTGAAtgagcacgtgctggaggtgccGTTCCT
GCAGGCGCCACCGCTTCACCCGCTGTCGCCTGTACCCATGCCAATGCCCCGGCCCCACGAAGGCTTTTGACCCACTTGACCATCACCCATGCAAATAGAA
AACGAAGCCTGAACATGTTTTGCGCTCGCGCAAAAAGTTGTTGCAACTTGATTCCTAACTTGTTCGGGCTTTTGTCTAGTTCTGTTGGTTTGGATAGCGC
GCCCTCTGCAATACTATGTGCATTTGCGCAAGCTCAGACTCTGAGCCTCAGAGTGCTTTCACCCTGCGGGGTGGCATcacttcttgttgctgtctTTCAC
ACAGAGCGTCcaggagacgacgagcgcttcctcggTTCGCATGTACTTTACGTGAACGGCATCAGCCACGCTCACAGTATAAGTTCCCCCCGCTTGGACC
ACTACTTCTTGCAGATTCCAacccagcagctgcatcaACATTAAAAAACATTACACGACGTTAGTTCATAATCCGCAGACTCATATCACCCTCAGCACCA
GTATTCCTCACCTCTGTGCATGCCTTAGCATCAAGATCTAGCTCGAGTGTCGGTGACCCAGGCTTTACGCTGCTCTGTCCCACCAGAAGAGCGAAAGCGT
TTGGGTGGACTCCATCCAGGCGCTCCTCGAAGCTAAACGAGGACTTCTTAACCACCGGCGTGGAAATCGATTTGGAAGCCGCTTTGCAGTCAATCTGAAG
CACACTCTTCCGCATGTGCGATACAAGCTGCCATTTTACCCGCTGAGCTTCAGGCAGCGAATGCCGTGTATCGCGCTCTTgaagcaccagcatctccgtT
TGCTGTTTCGCAAGCGCCTGGTtcgcctccaccagcttctgaCGTAGTGTTGCAAGCTCGTCACTATTGGCGGCTTtggttggtggtgctgctactgctg
ctggtgtctCTGTTGtagatgctggagcagacgATGAAGGAAGCAGCGGCTTGACTTGCTCCtggaacttgtccacgatTGTCTGTAGCTGTGAAGTATA
AACATCCGTATCCCGCTTTTGAATCCGTTGCGCCACCATGGCCCTGCCCAATTCATGTCGAAGTGCGCGGCACTCAGCGTAGTagcgctccttctcctca
AGACCGACTCTCCAGCCGGCCTGCGAATCGCTTGGGAAGGAGGAGGATGGAGCGAGGACACTGGGAGGTACAGTACCAGAACTACTAGACCCGGGAGCTG
TCGTTCCCATTGTGAGAATGGAGGCATCTGTGGGGAAATATGTCGAGTTCATC