Description :
From Genome Similarity Track
Location :
Scaffold_1645:4793- 6524
Sequence
1731 bases(100 bases per row)
TACTAACTTTCTTCAGCAACCTGCACCATTTGTAGGCGATTCTCTCGTCTCTTCTGTCGCAAGTAATCAAACAACAGGCCTCCACAGGAGAGATTTGCTA
GCGGTTCCCAAGTTTATTCGTCATAGCCAATCCACTTGACCTTGAATAATCTCCGGGTCCGATAAGTGCTCGTCGAAAGTGGTATCTTATCATCCAATAT
AGCTTCAGCTTCATATTTGCCTGCATCCTCGCTGACTTCCCAGCTGTCTTCAGGAAGCAATTCTTCGTCAAAGCCAAAGCGTTGAGCTTCACTCAGCTCG
TCCGCTAACCTCGCTGTTGGTCTCGTTTCCGGGTCAGCTACTGCTTTCAGCCGAGACACGTGCACCACAGGATAGAACGGTAACCACTCTTGTCAGGCAA
CACGAGCTCATACGCAAATTCTTCAACCTTCATCTTCACCCGGAATGGACCATGCCATCGGTGGGccagtttcttcttcaagtcAGGTTTCACCCGCTCC
ATGAACAGCCACACTTGGTCTCCTGCCTTGATCAACGATTGTTGCGGTCCAGCTGACTCGGCTGTAGCctcatcttcgtctccagctgAGTCTATTGCAT
CTTCCGCTGAGTTCTCTGTGTCTtccgccgagttcctggcgCTTGAAATAACTCTTCGTTCCCTCTTGCTGACCTTAGCGTTACGTTCTTTCGCCCGCCG
AGTTTTCTCCGTTAGCTGGTATTCTTTCGCTAGTTGGAGTGCGATTTCCCGTTggcgcttctcgtcgccatTGCGTAGCTTCCGCTGAGTTCACAGGGTC
GTTCTTAATATTCGACGTCATTGCTTTCAGGGTGTACTGAGCGTCCCAGCCGTGCACAAGGTAAAATGGAGTCTCCCGCCGAGTTGTGTCTCGCGAGTAG
TTGATAGCATATACCATCTTCTCAGCGATATCATCCCAGTCAGCTTGTAAGGGATCCTCCACATAAACTCGGACTGTCTGGATCATCGTCTTAACCGAGC
GCTCCTGCTGTCCATTTGCTTGAGGTCGATAACTCAGCGTGGCTCTGGATCTCGATTACATCAACTCAGCGAACGCTTGGAAGACTTCACTCATGAATCG
TGGGTTTCGATCGTGCCGGATCAGCGATGGCGCTCCAAACCGCCGGAAGACACATTCCTCGAACGCTTTAGCCACTTCCAGTGCCCCAGTGTCGCTCATT
GCTCTAGCGATCACGTATCCGGTGAAGTGGTCTTGAAAGAGAAGCAAAGCTGTGTTACCTCGCTGAGTTCTTGGTAGCGGAATAACAAAGTTCATTGACA
CCATCTGAAATGGTCGGTCGGACACCACATTTCCTGGCGAGAAACCTCGCAGTTGGGGTTTGCTTTTGCTCGTGCTACAGTCTCCGCACCTCTGAACATG
CTTTATTACATCAGCGTACAAGCCAACCCAGTAGAACTCGGCTTTCACCCTATGGAAGAACCGTACAATGCTTTGGTGTCCGCCCTCGATCGAATTGTGG
CAGCTCTGGAGTACTTCGTCGATCATGGTGGGCGGGACTACTAGCCGTAACGTTAGGTCATCACCATTGGACCCAGctcggcttcttcgttgCCCCAAGT
TGTACAACAGTCCGTCCTCGCTGAGGACGAAGTTATCGGTAATTTTGCTGGCATTCTGTGTCCGTCGGTGTGTAAGACCGTCGAGTTCGCCTTGAAGTAC
TGCTTTCACGTCTGTCCACTTTGCTTCTTCC