Description :
From Genome Similarity Track
Location :
scaffold_220:47927- 51268
Transcript NameFunction/comments
g5869.t1 conserved hypothetical protein
g5870.t1 conserved hypothetical protein
g5871.t1 cleavage induced hypothetical protein
g5872.t1 hypothetical protein PHYSODRAFT_342924

Sequence
3341 bases(100 bases per row)
AGCGTCTTGAACACGGGACTCTGGCTCGTGACGCCCTGGATCAGGTCCATGGACACCGGGTGCTTGTTCAGATGCTCGCGCACTCGAGCGGTCTCGAACG
CCAGTCGCGCCTGGGCGCTCAGCGCACGCAGCACGTCCAGACGCAGTGCCAAGTCGCCGCTCTCGAAATGCTCCACGACGCGCTCAATGGCGGCGTCTAC
ATCGGCCGCGATGCTGCAGCCGCGGCGGTCGTACGCTCCAGCCGACATGGTCTCCACTGCGCAATTGATACACTGACGTACTTGCAGCGATTGGAGCAGA
TATCACGGACTTAAACGGGAGAAAGTGTAGGTTTCATGCAGCAAATCTGATACGAATCAGACTTATTGTGCGGACTTAAGTGAATGCTAAGCGTCACCAG
TCGTCAAAGAGCTCCATAACGGATTGTTGCAAATTGAGAGCGAACTGCTGCCGATGGACGCGGATCACGCCATGGACGACGCCTCTGCGCCCCCGACGCA
GTACACGCAGCAGATCTCAGCCGCCGAGTACGAGCGCCAGGCCGTGGAGTTCACGACGCAGGAGGTGGAGCGCTTGAACGCCGCCGTGCGCGCGCAGCCG
GAGATCGGCGCCCGTTCCGAGTTTTTCCAGGACGAGGAGAACGTGGCCAAGGGACTTCCCGTTTTCCAGGGCAAGCACACGCGTTTCGTGTACGATGACG
AGGAGGAGGAGATTGTAGCGGCCGTGGATGTGACCCAGGAGGCGCTGAACAGTGGACCGGTGGTGCGCACAGTCGCGGAGCTGGACGAGGACGTCGATGA
AGAAGAAGAAGAAGAATACGAGGAGGAGCAGGATGAGGCTGTGCAGAACCATTTCTACAACGCAGAACAGGAAGGTGAAATGGTCGTGGACGACGCGCAC
GTCAACGCTCTAATGGAAGATGTGGAGATGGAAATGGCAGCGGTGGCCATTGACGAGCAGAAACTGCTGCACGCGGCAGGTCCGAGGCAGTGAAGTTGGT
GCCAAACGTGTATTTTAGACGCCTTTGCTGGCAGTTTGCATGAGGAAAATTCAAGAAGGAGGAGGGTAATAGAGCGGTTTTAGGCTTGTGCATATCAACT
ACCGGGCGTTATGGCCTTGTCAACTTGCTCTCCTGTGTGACTAGAATACTTTAAACTTGGAGAGGAAGCCTGATTTCTGCGGCGTATTGCCTGTCTTTTC
CGCCTTGAGTCGATCCTTGAGTGTCTTGGGCTGCAGTTGCTGTAGGAACGACTTGTGGTCTTGCTTGAGCACGAGCATAGTGTTCTCCTTGATGGGCTCA
AACATGGTCTTAATGGGGCAGCCCAGTCGAAGCTGGACGGACTTGCGGTCCAGATTCGTACACGAGACCTCGTACGGAGACCCCGGCGCGATGAAGTACA
GGTACAGGTTCCATGCAAAGTCCTTGAGGTCGTCCGCCTTCATCTGCAGCGCCATCTCCTCGAACCGCCGGATCTGCCGCGCGCATTTGAGGTTTTCCGC
CTTGAATTCTGTAGGAAGAGGACCAGTTAGTCTACAGTTTGCGTCAACATACACAGATAGAAAGCTGCAACGTACTCTTCTCAAGGTAGTCGAGCATCTC
TCGGAACAGGATCTTGTCGCCTAGGATGTCGTCCAGAGAGAAGTTCCCTTTGGCGATCTTCTCGTCCGTTAGCGTCGTGACTGTGGGCAGGTCGACCTGG
TACGAGCTGTCCGAGTCGAAGACCTTCTTGACGATCATCTCGTGTACGGCCGACACCTTCGTCGCCATCTCCGTGTACTGCTGCGCCTTGAGGAAGCGCA
TGAGCGTGTCTTTCTGCAGCGTTTTGATGGCGTCCTGCATAGCCACGTCGAACAGTTTGGCTCGGAATTCGCCAGGCCGCTTCATCCGCTCCTTCGTCTG
TTCTCGATCGTCCGAAGGCAAACTCACCTCATTGGGAGAGTTCAACGACAGGAAATCGGCCCAGATCTGGTCTGCCATCTCCTTGCACGACTGCACGGAC
TCCGGGTCGCGGAAGTCCAGCAGTCCGCACTCGTCCTTAAATTTGTCCACCGCCATGAAGAAGTTGAGGTTTTCAGCGCAATACTGCAGAGAGTTTATCT
GTTAGTTAAAGCGCGACCAAGCTCTGATGTGGCTAAAACGTACTTGTTTCTGGCAAAAGTCGAGCAGATAGCCACAGGAGACGGGGTTCGAGATGATGTC
GTCGATGACGATGTCGCGCTTGTCCTTGGCACCTTTCTCCAGCACTTTGACGAGCGTCTCGATCTCATTGCCGCCCTTCTTCGCCATGGTCTATACAAGT
CGCTACTGGAGACGCGAGCGAGTGAGTGCTGCAACGGACGCAGGCAGACGGAGAAGCAGGAGTGGGCGACAATCAGGAGGCCACCTTGAATGCAGTTTAT
TTTGGTACAAATACACATTACGTTTCTTCCTCCAGAGCTGAGTTAAATGCAGTGAAGAACCATCCCAAACATCGACCGATTTAGCTGATCAGCAGCTTCA
CAAAGCTTTATTTCGAGGACGATGTGAACACCTTCAAGGTGCTAGGAATCAAAGCCTAGTATGACAACGAATTGATACGGTACTGCTGCGTTATTTGCCA
CTAACACAAGCACATTGATTCGAAGACGTAGTAGAATGAGGTAGATTTTAAAAAGCTAAAGCTAAGATGAATGAGAAACGAAGGTGGCTGGGCCTGAAGC
ACGCCGTACTCTGCCTCCCTTTCCATCCTATGAGCTCTTGCTACTCGTATCATCCGGGCCCTGGAACGCGCTCGTGACGTAGCCCATACCCGATGACACA
GCTCCCGTGGCGCGCTCCATCAGCGTCGGTTCCGCCGGCTTCATCTTGTCGGAGGCCTCCGACGCCTTGTTGGAGATGCCGTCGGCAGCGGACGAGGCCT
GATCCGCCATCGACTTCTGGTAGGTCGAGAACTGGTTCTGCAGTGACTCGAAGCCGTGGAACGTCGAGTCTCGCGTGGAACTGACAAGTGAAGAGATCGA
ATCCTGCCATGACGTCGCCGTCTTGGAGCCACTGTCCTTCGCGTTGTCAACACTCGAGTTGATGGAGTCGCGGAGGTGTTGGTCGTAGTCCTGAGCGGAC
TTGCCCAGGTCGTCCAGCGCCGAACCGGCCTGCTCCATGGAGCGCTTAGCCGCGTCGACGACCTGGTCGGACGCGTGGTTTCCGCTTTGGCGGACATCCT
CACTCGAGCGCTTGAACTGATCGACGGAGGATCTGGCCCGGTCCATGGCCGTTTGGAAGTAGGACGTGGCCGTCTCCTTGGAGGACTTGTGCGAGTTGTC
GTAGTCGGAGAACTTGCTCTTGAGCGAGTCGAGGTAGCTCG