Description :
From Genome Similarity Track
Location :
Scaffold_125:47924- 56763
Transcript NameFunction/comments
Phyta_totarag4128conserved hypothetical protein
Phyta_totarag4129hypothetical protein
Phyta_totarag4130hypothetical protein PHYSODRAFT_397963
Phyta_totarag4131hypothetical protein
Phyta_totarag4132hypothetical protein

Sequence
8839 bases(100 bases per row)
CGTCGGGCGAATGCCTTCCAGCTCGTGTCGGACAAAGTGCACACCTACTACCAGAGCTTTTCGCACGGATACGACCCAACCCGGAGCAACGCGTGGGAGC
CAGAGGCGCTACTGCGAAGCATGATGCTGCCAGATGTGCAGTCTCCAGCGTTCCGCGACCTGGACACGTTCTTGGAACAATGGCATAATTACTCGCGCTA
TCACGCCGAAATTTCACTGCACTGCGAGCAGATCCAACCGCTGGAGAGCGAAGACCCAGATGTGTATCCTGTTCAGTGCGTCGGCCGCTCCACCCTGCGA
ATCTCGCGCGACACCATCATACACTTTTTCCAACCGCTGCTCgccgacgaagagctggtgCAGCGCCTCATTGGTAAGACCTACGACTTTACTTTCGTGT
CGCGtttccacttcaactcgagcGGCCGAGTGTTCAAGATGGAGCCACGAGCCGAATTGGCGTCAGGTCTCTTCGACCTCGTCGTGGATCCGTTCTCGAC
TGTACGCATGCTTGGCGCCTCCAAACTATCCGAAGATGGTTGTCTGCACGCCTACGCGaaccaagctgctgccaatcCAGCAGTGGCGGGTCTGTAGTTG
TCAGAGGAAAGCGAAACTTCGGTCACTATCCATCGCCGATGTGGCCAGGAAAAGTAGTGAGTGCCATTTTCAAAATTGCGAGTATTTCTCCTATAATAAG
GGTAAGTGTTTCAAGGGTATCTCGAGGAAACGATCTCCCAACTTGCCCCGATGCAGCTCCTAGTGTGGATTGGTGCTGCCTTCGTTGTGTTCGCACTTCG
TGATGTTCAGGGGGAAGTACGATATCAGATGCGTACATTTCGCGCTATTGAGCACGACTTGAGGATCGTGGACAGCCCTGAACAGTTTTTAGATGACCGA
TTTCTCGggggagacgacgatgacgatgacgacgacgacgacgatgatgattGCTAGCAGCCTAGCTGGGAAGATTTTCCTGAAAGTTCCATCCTAACTG
CCAAAACACTAATGCAAATGCAACGATTTTGTGCCAAGGTTTGATATACATGAAGCAAGTTCTTGAGCACAAACGGATCCCGGTTTTCCTCGTGGAATCA
CGCAGGTCTCACTACCGGCTCACCCTCAACGCTGATAGCAatgcgcttcttccagcaacttATCGGGTTTGCCAGTGTTGCCACTTTCACTGTCGCTTTG
GGTGATGCTGTAGTCTGCTGTGGAATGGCAAGCAACACGAGAGTACTGGAACCAGCCCTCGAAACCGCAGCCGTGACACTGAAGGAAGACAATGGCAAGG
ACTTCAAACCACGCATCcttcaccgccaccaccgcaacgatggcgatgacgacgacgatgacggtgACTGAGCACACGTAGCCTTGGGAACTGTTCGGCG
GAGCAAGGCAGCCGGAAAACTCACTAGGGCGGGGTTTAAGGTAGGAAATGAATTTCATTCCTTGCTCTTACTTGTTCGATGAAATAGCATAGCCGAAACT
TGTGTGAAGTACTTCGTAGTGGTACCAGCAACTCGACCAACCCAGATGCATATGTCGGTGCTAGAGGTTAGGAAATAATATGGCAATGCTGCCCTTCAGA
ATCGGTGAGCTTTTGGACCGCTTCAGGCAGCACACCACCGTTCGCATTGGCTCGATCAAACGTGTTCTTCTGTAGTTCACTGGATGCGTAGATGTACAAG
GGGCTGTTAGTACAACAAACATTACAaagtgctgcttgcgctACTCACAGGAACTCCAGCTTGGTCAGTTCTGCTAGTGACGCTGGAATGGTGCCCACGA
AATGATTATGATCGAGCCGTAGAGTGCGCAGGGCACTAATTCGAGACAAAGTGTCCGGTACGTAGCCAGTCAAGAAATTGGAACTTAGATCTCTGCAAGC
ATCGTGACTTGATTAGCTTCCGATGATTTTAAGCGAGCAGGATTGCGGAAAGTGCGGCAAACTCACAGCTCTTGCAGGCCGCTGAGGTCTTTGCGAGGGA
ACTCTGGCGGTAGGACCCCCGCAAGGTTGTTATTGGCAAgacgactgcaacagcaaacagcgaTAGCAAACATCAGGTAAGTAGCgaggcgtccagcagc
agattaACTCAATCCCACTCACATGGATCGGATGCGGTTGTTGCGGTCACACACGATGCCGTACCActagagcagcaacacaatACAGACGTATCCATGA
TAGGTAAGATTACAGTTGGGTACGGCCCACGCACAGCTTTTTGCTCGCGTACGCCGTCAAGGCACGGGTCGCTGTGCTCGTTCTGAATGTCCCATTGAGC
CACCCAGCGTTGGCCATGCGTGGCCCAGTAGAGCAACTTTAGTGCGCCGCGTTCGTTCCTGGTGATAGCTGTCGATGGGTTCacccacgacagcagcaaa
aagaCAACGGCAGCTGCGgtctggtggtgctgcatcaGGGCAAAACTGCAACGCAGCCATGAGCTTGACACATGGCTACAATTAGATGATATTTTTCTAC
ACGAAAAAAGGCAACTTTAGCTGCAAAGCATCGACTTTCAAAAGTAGCTCATTCAAGACTGTACATGGAACTGTGTTCGGGCATGGTGcaagcactgctg
cagcagcaggctggTTCGGCGTAGTAGCCATCTTGGAGCCTAGATGTGTGGCATCGTCCGTGCTCTTTGCAACCTTCTTGTCCGGTGACCACTTCATGCC
CCTGGGGTTAATTCGACTCAGAATGTATTCCTTCACGGGTGTGGCTATGTCTAGGAATCCTAATATGATGGACCCTCCCCGATAAAGTAACGAAGCTACT
TATCTCAGTCCCGTATAAGTTAACCTGGTAACTTTAGCAGGTCAGTTCAAAAGCGCACCAGTCCCCAATAGCACGCCGACATGCTACTGGAAAAGCCCGA
GGACGTCAAGCACGAGAACTCGTCGGGCACCGGTGCGTGTGGATCCTCTTGTCGAGACGCATGCGTAGCTGATGTCGCGTTTGTGGCGCCCTCATTCGCT
CTAACTAACGCGTTCTTGTGTGCTGACAACGGCTGATGCCCTCGCTCTGCAGTGTGCGCCATCTACGGCGTGGACGCGCAcccgacgctgcagctgttcg
CGACGGCCGGAGGAGACAACAGCGTCAAGATCTGGTCGCTGCAGATGCCGCCCGAGGGAGGCATCGCCTcattcgagctgctggccactCTGGCGAACCA
CCAACAGGCCGTCAACTGCGTGCGCTGGGCGGGCCACGGCCGCTACTTGGCCTCGGGATCGGACGAccagctggtgctgctctacgagctgcaggcgggC
GCCCCAGCCTCCGTCCCCTTCGGCTCCAAAGCGAGGCCCAACAAGCAGAACTGGGTGCGCTGCGCCACGCTCGAGAGACACACGATGGGTGAGACGAGgc
ttctctctctctctctggCTGCGGAGGTTGGCTGGTTCTAATAGTGCTGGTGTGTGTGCAGATGTGGCAGACGTGGCCTGGTCGCCGGACGACCGCATGC
TGGCCAcctgcagcatcgacaacaCCATTTTGATCTGGGATGTGGGTGCTGGGGGACTCAGTGAAGTCATGACGCAGCCGCTGCAAACGCTGACGGGGCA
CAATGGTTGGGTCAAGGGCGTTGCGTGGGATCCTGTCGGCAAGGTATTTTTTTTTGGTTTTTCCATTACAGCGTGACAAATGCCAATCGAGTAGTGTCTC
TGACGGACGTTTGCTGCTTTGTGCTGCAGTATCTGTCGAGTGCTGGAGAGGACAAGACGGTGCGGATGTGGAAAGTGGCCGATTGGCAGGAGTCCGACGT
TGTGACGGAGCCGTTTGAGGGTTGTGCTTCCACATCGCACTTCCGTCGGTTGTCATGGTCTCCTGACGGCTCTGTCCTCTGTGCTACACACGCTTTCAGC
TCCAAGAAAAATATCGCAGCACTATTAAACCGCGGATCCTGGACAAACGACCTTAAATTTGTCGGTCACCAGAGTGTTGTGACCAGTGCTCGGTTCAATC
CCAAGCTGCTTGGTACGTCGATGAAATGGTATTGAAATGCCATTACACCCATGCTAATAATTTTGTGTTTCATCTATTTGCTCTGCAGTGACTAAGGCAG
ACCCAGATAAGGAATTTGCATGCTGTGCAGTGGGTGGTGAGGACGCGACTGTAAGCATCTGGTTGGCTCATTTAGCACGTCCACTGGCGGTCATTAAGGA
TTGCTTTGACTCGTCCGTGACGGACCTAACCTGGTCCAGTTCCCAGTCACTCCTCCTCGCTTGCTCGCTCGACGGCTCCGTCTGCTGCTTTCAGTTTGGG
GGGGATGAGATTGGCACTCCAATTTCTGATGCACAGCAGAGTAAGCTTCTCCAGGCAAAGGTACGTTGCTCGCAACCTACTTCTTGAAGGCGGTTTTAGT
CAATAAGGCCTAACATTTAATGTTTCTTGAATGCTTGGAATTGTCTGAAGTATGGATCCCGGGCCGGCATTACGCTTGCATCGACATTGGTGGAGAACCC
AATCCAGCTTCAGGTACgcttgctacatgtagtcccACGTGCCAGTTGGTATGGGACGAGGTTAGTTATTCACCGAATACATCTTGCTGCGTGTAGCTTG
AAGAAAAGTCGACGACTTCACCACGGTTGGCTATCAGTCGGAGTTCTGGCACCAGTGCTGCTCCCATGGCGACCCACACAACAAATACACTCAtcccgaa
gaagaaaaagaagctAGGTACTACGGCATTCAGTACGCCACAAAGCAGACCACCAAGCGGAGCAAGCGACAACGATAAAAAGCGATTCGCTCCTGTACTA
CTTCAAACGGACGCGCAGCTTTTAGCCAACAACCCAGCCTCATCGCAGAACAATATTCGCAACATCTTGGGCCCGACGGTCATATCGCCGACGGCGTCGG
ACGTCACACTCCTGGATACTCGCATGGCGTCAACGAGTGGGAAGGAGGTTAGTGTTGCCCCTGAGGCCAATAATTCTGCTACGCTCAAGTCGAACTCTGC
GCCGAGTCATAGTGATAAGAGTGGGCCAACCCCCAAGGAGaagcctgctgcagcaacgacgactgACGCACCGTCTAAATCGGTGAAGATagagctgaag
aagaacgggGTCGATGGGACTTCTTTGAAGAGAAAGCGAGAAAGTGAACGACCTCCAACTCAAACCGCCGCCGTGGTAGCAAAGTCAAGAGAGGTTGTCG
CGCGAGCGCCGAAACTACTGAACGAAAGGTTGGTTCGCCTAATGCACATCATTAATGATGTTTTAACTACTGACTGATGGTGCGTTGTATTTTGTGCGGT
GAGAGCAGTAGTGGTGGTGTGGCCAGTGGGGGTCAGTTGTTACCTGAATTTCCTTTCCGGCTGCTGTTCTCCGTAGAAATAGACACGAGTACACAgtcca
gcacttcaagctcaagcttGAATGGCAACACAAGAAGCGGGTTGGTGTCTTCTAAAGTGGTGGTAGAAGTTACCGTTCATAACCTGAAGAACCCTCAGCC
AGAGGAAATCATAGGTGAGCTGTGGACGATGGAGTCGTCTTGTTCGCTTTACACGAATGATCGCTGATGCTCTTGATCAATTGGATGCTCCACAGAGTTA
GGTCCAGTTTATTCAACGGTTAAATGCTCCGAGGGAAGCGAGATCAAGTGGATCGATCGAGTCCCTGGTCGAGCCGTTTGCGCAGTGGGAAACGCGAGCT
ATTGTGCAGTTGGTGTTCACAACGGCGACCTCCTGGTTCTCAATAGCAATGGACGACGCTTGTTTCCGTGCATTGGTGCGTTTGCGAGCCTATACAATTT
GGTTGCTCATAGACTGACATTTGCCACGTTGCTCTTTGCTAGCTTTGGGCAGTGCTATCTCAGTAATGGAGTGCAGTATGAGTGAGTCGCCCTATTTGTT
GGTGATCCTGGCGACAGGCGAACTAAAAATCTGGGACCTAGCTGAGCGCAAGCTCGTTCTCTCAAGCTCAATCGAGGCAATTACAACTGTGAGTTTTCCC
TTTGTGATTTCATTAGGATGGCGCTTTGTTTCTGAGTTTTCTTCGTGCCGAATGTGGGTATCATAGATCACACCAGAAGATCATCACAAGCTGACTCTTC
TTCGGTGCCAAATTACAACGAAGGGAATGCCGCTTATCACGTTTGCCGAGTCGAACTCCGAAACGAAAGGCAGTTCTAGCCTGTTGTCATACACATTCGA
CACAGCGATGTCCTCCTGGTACGAATTTCTCTTATGAAATCCGACGAGAAGTGCGCGACTAACGCATGTAAGAGCGAGATGCTAACCTCACTTTTATGCT
TTTATTTTTAAAGGATGCGAGTGGCGGACGACAGCTTTGTGTTCTCGGACTTTGCATCTGCTCTCCCGACAGATGCGGTGACAGTTAAAAGCGTCCCCGT
ACGCGTGCGTTTCACCTATTGTCGTTGCTGACCAGATACTAATTACTGGAGTTCTTCGACTTTGCATTGTGTACAATAGATTGGTCCATTGCGGCGGCTC
CAAAATGCCTCTGGCTATGGCCGAACCCAGAGAGGAGTCGCTTCAGCCATGCTCTCCGGGATGTCTGACCCGCTGATGCAGCGCAATGTGACGCGCTCGC
ACCTCGAGCACCAGGTCGCCGCTGCGATCGTGCTGAAAAGCTCGACTGAATATCGCTACTGGTACGTTTCGATCACCGTGACCAAGATGATACAtagtgt
tgctgctgctgatttCCTTTACTTCGTCTTGATCAACAGGATACAGGCGTATGCGAGGTTCCTGACgcacgacgaagacgtgcCTCGCTTGGATGACCTG
TGCGCTGAAATGATGGGCCCCTTCCACGCGTAAGTTTGTGTTACCGGCTAACGTTGTTGATATAGAGAACCCTAAGCGTAATGCCTactctgctgcagat
cgtcaacttcaagcACAGACAATGGCAAGAACCCCAAACTAGATGAGGGCGGCGAGTGGGATCCAATGGTCCTGGTACGTGGCTCTGTACATATTTCATT
TGCAATGACCAACTCGTCATTGTGGTGCTTTTGGGACTGACGCCCTGAATTGACAACAGGACCTCGTTAAACGGGACGTGTTGAAGTCACACATCCTGCC
GACGATTGCGGCGAACCGCGCGTTGCAGCGCGTGGTGACGAAGTACCAGCTCATGCTGAGCGAGATCGAGGCCcgcgagaaggacgacgaagacgagggc
GAGTCTTAGCAACGGTGTCTGGTGCATGTAGCACCCATGTCGCAGCTCTGATCTAATGAAAGAGGTAGCAACCTTGTTGCTTGCTCAATCTCCTCATCCG
GCGCTCTTTCTTGAAATGTTCAGCGCCGACGACTAGCGGCATGATGCCGCTGCGGCGACAGTTCCGTCCAGTAGTTGCTGTTCCGCCCAACGCTTGAATT
AGAAGGTGCGTTTCGTTTGAAGCAGTGGCGATCCATTAGGCCAACGCTAACTCTGGCTTGCCTTGCGTCTCGGGGCAGCTCTGGCAGATAGGCAAACtgt
tgaacttcttgatCTGCACCTCGCTGCGCGTGTCTGCGCTTGCCTTCACTCACGTATATCACGATGCCAAGTAAGGCAGTGCTGTATACGACCACTGCTG
CCGTgcatcgacgtcgacagaACCTCATGGTCGACTCGCTGACTGATCCCGGTGTAATGTCCGTAGCCGTAGTTGAAGCGCCTCGCAGCCGCAGGGTTCA
ACCTCCGTGCGTCTGGCAGCCGATATCGCACGGTGCTTGGGCCCAGATACACATTTACGCCGAAGTTGATCGGTACACTTCCGAGACGCACTTCCGCATC
GTGGCATGGATTCTAGAGTCTGGCGCAGTCGTCGTGAATGATATCCTTAGTGTCGGCTGCCGGTGGTGGCAAAGTTCTTGCGACGATAGGGCCTTTCGCC
GACTTACAGCTGTAGATGGCCGCACCAACGGTTTTCAGTTCCATTCCGCGACGAAAGCTATCGAGTGCTCACGTATCGTCGATCACGTCCTCGCTAATAT
TCCGGGTAGGAGAACAGCAAGTACTTGTATATCGAACATGCTCACATGGATCTGCCCTTGTAACATATGTGCTTGTTCTCGTACAGGAGGTTTGAAGGTC
GTCACGAAGCTGATGCGAGCTAACGTTGATCTTCAGGGCGTACGTTTTTCGTGTCGTTTTCATGCTGAGTTTTTGCATCACCGTGCTGACATTTTTTGTA
GGTTGTCATGGCGTGGCAGGGCTTCGGGTTACATTCCATCCATTACCCGCCACACGCACCCCGCGTTCATTCCGAGACTACCTCTTCATCCCCTTCGTCA
TCGTTTTCGGAGACAAGATTTGGCCGGCGTACCATGTATCCCAAAGAGCAAGAGGTGAGTTCTTCCTGGCAcgtagagcagcagcaagaagcagaaacgt
CTGGGAAACCAAAGACCCCCAACACAGTTGAAGGACCGGAGGACGATTCTTCACtggcagatgaagaagaaaacaacAACCAAACGGACGACATGTCAAG
CAGAGTGCCTTCCTCACCTGTTGCCCTTCTTGAAACTTGCGACGCCATGGATATGGAATCGCGGTTTGCATCTCTAACGAAGCGATCACGTGGAGAATGG
ATTAGTCGTCCTTACAGGACTCGGGGGGAGATCCACGTCACCTATGACGTGGAGCATGCGCGCTATGAAGGACTACCGGATGCGTGGCGAACATTGAACC
ATCAGTTCGGCTTACCGCTTGAGGAAGTACTCAAGCGGGAGGTAGAAGGGTACGAAACCAAGCTCCCCGCAGTGCTGGAAATGATGAAGACTTGCTTTCT
GGCACACGATGGAGCTTACACGGAAGGAGTATTCCGCGT