Description :
From Genome Similarity Track
Location :
Scaffold_748:4791- 6018
Transcript NameFunction/comments
Phypl_g10731conserved hypothetical protein

Sequence
1227 bases(100 bases per row)
GTGGCTCGGCGCGTCGGCAAAGTAGGTTTGTAGGATAAATGCGCGTGAGAGGAGCGGCTCAATCTCGTTGTCATCCCAGTCCTTCGTCGGGAGGCTTTGC
AAAAAGAGAACCAGATCTTGGAactccagcgtcttgagtTTCTCACCAAACGTCATGAGAATGGCAGCGCACACGTATACGTGGAAGCTCTCAAAGCCCG
AGTCTTCGCACAGGTATGTATCCCAGATGCGCACAATGCCATCCAGTGGTAGCTCACGCATTAACAAACAGTTCATCCAGCGGAACGCAAACTGCACGAA
CTGCACATTCTCTCGCTCCACGATAtgctcgaacagctccgcGTCGCACCTGTGGACGAGTTCCTCCATGCGCTGAACCATACGCTGCAGACCTGGCTGA
GCAAACGTGTAGTGATCTTGGATGtcgtcaagcagcttcgtcaggCACCAGTAGCTGTCCGCCTCGACAATCTGCAAGTTCTCGTCCGACACCTTGGACA
AGTCGCACGTCTGCGGCTCATCTACACCAACGAACACAACAAATGCGTCATATTAGCTGGTACTGCAGGCAATACGTCTTTAGAGCCGATTGTACCAGTA
ACAACTTACCGACGAAAGCCGAAAGAAACACGACCAAGAACGGCGTCATGAGGTCATTAATCCCCTGCACGTAGCCACTGGCTGGGTGTCGAATTGCCCA
GATGTATAGGACGCGTTCCATGCACTACATTCCCACGCGAACAAGCCCACCAAGAGACTTCTGTCAATGCACCGTAAACTCCCGAGCTGATAGCGTCACT
GCCTCACCTGGTGAATACGCTCGTTTTGGAAGAGCTTCACGTCGGCGTTGGTGCGTGGAATATCAACGAGGATCTGCCGTAGCGTGGTTTGCTCGCGCGT
ACCCCGATCCGTGTCTGGGATGTAATAAtactgctggagcagctccacgtaTTCCTGGCGCTTTCGTTCCAGCATGGCGGCACGCCGATCCTTCTTCGAT
GGCATGTAGCCCTGCAAGCAAACACAATATCGATAAATGAAAACTGATTCCATCGCATATCGAACTACGAAAGCAGTAAcataccagcagcaaccgccaT
ACGGTAGGCCGATGTTTCGTAGGGACGCCACCCCAGCTGAGCTTTCGAAGCTGGTCCGGATCAACGACTTCCTTCTCCATCAACTGCTCGAACTGCGTGT
ACCGAAGGTTCCCCGACGCATTACgcg