Description :
From Genome Similarity Track
Location :
Scaffold_100:4790- 8247
Sequence
3457 bases(100 bases per row)
CCGATTGCGAAATCGCTGGCGTCACAGACCACATGGAATGGTCTGTCTTGGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCTGATTCATACTTTCAAAGGAACGCTAACAATTCAGCGTTCCATGACCATTTCTCGTT
CTTTTCAAGAGACGAGAGAGATGAACGGTCATCTCGACGTAGTTGCGCGAGTACTTGTGTAAGTACGCCGCTAGACCATGGAACTTTCTAAGTCCGTTAA
CGTTGACTGGCACAGGCCAGTCGGTAATCGCCTTAATCCTTTATGGATCAGGGCGTACGCCGTGTTTACCCACGAGGGGCCCAAGAAGTGGTATTTCGCT
AAAAGCGAATATGCACTTCTTGAGGTTGGCATACAGCTTATGCTTACGAATAAGTGTAAGAACCTGAAAAACGTGAGTTCTATGAACCTTTACGTCCGTC
TTTCCGCCCGTGCATCGTCGAAGTAACTCAGTGCGAAATCTCGCACCGGTCTCAACCGATTTATAGCACATCTGTTGAATGTGGCAGGGGCGTTGCTAAG
CCCTTGTGGCATTACTAGACACTGCCAGAGCATACCGCTCGGGGTGCTTACTGCCGTGTACGGGATGTCCCGTTCACGCAATAGGATATCATAGAAGCCA
TCCATATGATCCATGGACGTAAAGGTGGTACGCTTTGACATACCATCAATGATTACGTCCTTCCTCGGTATCGGCGTCTGAGCCGGTACCGTTGCAGCAT
CCAACTTGTTCAATGCGCGCAATATCCGCCATCCTCCTGTGGCCTTGAGCATACAGAAGGTCGGAAAGCTGTGAGGGAAAGTTGACTCCCTCACATGACC
CGCAGCTAAGCGATCGGCAAAGAACTTATCGATCGCAAGTACTTGTTCACGAGGCAGTTGCCACTGCTTCATGACACAGTACTTCGAGCCCAGTTTAAGC
TCGATTTCATGTCGAGTGCCTTTATCCTTAGGCAATTCTCATGGTACGGATTCATGGAACACGTCCTTGAATTCGATCAAATCCTTATATAAATGATTTG
CCTGAAGCGACTCCGCAGATCGAGACGTGTATCTCTCAATCCGAGTCTTCTCATCAAGGACACTTTCGTTCATTGATGAACCGCTGAGAACCTGTTCGTT
CTCTGCAAATAATACTGCCGACCGAATGTCAGTCACGTACTCATCCTTTGTGACGAGTACACAAATCTGCTTGATCTTGCCACTACGCAGATCTCGCAAG
AACCGTTTCTGTTCCAGCGTTGGCAATTGAGTGATCTCCGAAGTCAACTTCGGAGGCGCGATCAGATCAAGTGTACAAGCGCCTACACTTGAGCCGTCAT
TAACCAAGACATTCAATGTCTCAGTTTCTTCCTGGGAACTCTTTTCCACAGGCTGATGGGGACTTACTCCCTCAGGCAGATGAGGTCTCGTTACCTCACC
AATAACTGTTTGAGGAATTTCTTCCTCAAGTACGTGGGTACTTATTCCCTCGACTCCTTCTAGCTGTGGATGTGCTACCACAGCTAGTTTCTCTACGATC
GACTCTCCAGACGATCTAGGATCATCATGTTGCCCTGTGTGGGCAACTGGTTTATTCTTTCTTGGATGTCTCCCGCTAGACGTGCACCCATGTCCCGATC
CACTCGACTTATTCGAGTAATGGACCTTCGGCGCTGCCTGTGCATACGCACAGACGTCGGCAGCTTCCTCCACAGTGTGATTGGTTGTCACACTGTAATC
TTGTGCAGTCGTACTAACGACCGTACCGCAAGTAAGGCCATCGCACTCACTCGCAGTACATCCACACGCTTGTGAACGCTCCAAGACGTTCATCAGATGT
CCATCTGATGAACAAGTGGCCGGCATCTTCACGGTTAGATGCTGCCAGCTGACCCTTGGCTCGTACCTTATGAGCCAGAGTAACCCTAGGATGACATCAA
ATTTGTCATCCAAATCAAGTACGATGAAATCATCATTGTACTGCAAATCTTTTAACGTGTAGTGAAATCCCACTACACTTTTCTTCGCTGCTATCGATGC
GCCTGTTGTGAGGCGCACCGTTAGCCTCGTAGGAGGATTAACGCGCTCAACGAACTTGAGCCTACGATACTCTAGCGACCGGCGACGAACAAAGTTGTTC
GACGCCCCACAGTCAACTAAGGCACGAAGTGACAAATCTTTCGTCACTTCTAAATTCAAGGTGATGAGGGGTACCTCATCACCAAGTGCAGATACACGCA
AGGATTTTGAGTCTGAAGCAACTTTCATCAATAGGTTTGCAAATTCTATTGAGGTTGCTGGATCATTAAGGCGCTCCACCCACACTGACCCCGACCGTTT
TTGACGGTCCGCCACGCTGTTGTGACTTCGCAACAGCGTCGGACCCGCGTCCGTTGTCCTTCTCGGCTGACGGTCGATCACTTGTCTCAGTGTTACGAGA
CACTGGGCGTGAAGCACTACACTCGTAGGCGTAGTGTCCTAACTTCTGACAGCGAGTGTACTTTTGCAATTATTTACTGCTTGAAGAGCGAGGTCTCTCG
CTCTTAACACTGCAGAGGTCCATTGGTTCTGGACCTCCCGCCTCTACTCGTTTTGAGGGACGATAGGGGGTCAAGCTAGTGTGAGCCTGTCTCACACTAA
AGTCCTCTTGCACCACAGTTGTGATCGCTTCCTCAAGCGACTTCAACTCTGCGGAATAGGCGGTTCGTCACGGGACCATCTATGAGACCTTCAAGAGTAT
CGTGATCAAAACGAATTCACTTGCAGGATTCGCTACCATGCAACTTGCAACGTGACGAACGTGCTGAGCGTAAGCGTGAACATCACGCTTACCTTGTTTT
ATCTCCAGGAGCTCTGTTAGAGTCATGAACTCAGCTCTTTGCCGCTCAAACGTTTGGCTGAGCAGATTCATAAAGACCGCCAACGATTCAAACACGTTTG
GATCGTGTAATTGAAGATTCAGGGCCCAAGTTGTGGCACGCCCTGACAAATTCGATTTGGCAAACGCAACTTGCATTTCCTCGTCGTCGATGTGGCGAGC
CTTAATGGCATCGTCCACTTCGAGGAACCATCTCAACAGGGAGTCTTCCTCGACTCC