Description :
From Genome Similarity Track
Location :
Scaffold_418:479- 6271
Transcript NameFunction/comments
g10357.t1hypothetical protein
g10358.t1hypothetical protein

Sequence
5792 bases(100 bases per row)
CGTAGACAAGAGTCCCGAAGGGGCTGTACGTGGAGCGGCACGTAATCCGCTGAGCGGGACTCGTTGTGATAACGAGCCATCGCTGCAGGCCGTTGATGGC
ATGGTCGGCAGAAAGCCGAGGCATCGTGGGCATAGCCCTGATGATGCGCGTGGAGCGGCACGTTATCCGCTGAGCGGTGAGCGCCGCGATGGCGGAGAAT
CGCTGCGTGCCGACGATGGCGCGGTCGGCCACGAGCCGAGGCATCCTGGGCCCAGCCCTAACGATGCGTGTGGAGTGGCACATAACCCACTGGGTGGGGA
CTGCGAGCTATGCAGCTCCTCGCCGGATGTCGACTTTGACGTCGACGCTCCGATGAAGCAACAAGAGGTGGAAACACCTGAGGACACCTTTGGTGTGAAT
ATGCAGGCCTCCCCGAGGCGTATGGTCTCCGCGAGGAGACGGTAGCGACGCCGTGTGGCAGCTGCGAGACGCAAAGCGTCTGTTATGGCACAGCAAGTGT
CGGGAGTGGTGGATAGCGAACAGCTATATACACTCGTTAATGGAGTGACCGGCGAGGTCGCTGGCGACGTCAGCCTTGAGGCTGTTCCCGTCGCAGATGC
TCTGCTAGAGCTGGACGAAATGTCAATTGCCGAGTTCGGCGAGGCCTTAAAGGCGGGCGAATTAGCCGAGGTCGCTATTATACGACCTGAAGATGAGTTA
AATTCGTCTTCCCTTATGGACGAAGCAGTCCTGGAGGACACGAAGCAGGCGCTTAGTGCGCGTAGTGGATCGGCGATCCTGAAGGATCCTTCAGATCCGT
ACTATCCCTTGGTTAAGGAATACCAAGATGTCGTTTCCAACGATCCGCCTTCTGGCTTACCTCCAGATCGAGGCGTGCGTCATGAGATTGACCTGGTCCC
TGGAACCAAATCCTGCGTAACAAGGCAGTGGCCCTTGCCAAGGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAACACGAGGCGGGCATGGTG
CGCGAGAGCAAGTCTCCGCACTCGACGCCGACATTCTGTGTCAGAAAGTCAAACGGCAAGTGGCGCATTGTCCACGCTTTCAATAAGCTCAATGCCGCCA
CCATCCCGGCGCAGACGCCTATTCCTAGGAAGGATGTTCTCCAGAACAACATGGTTGGATGCACAGCATACAGTGCGCTCGACTTAGTCGATGGTTATTA
CCAGTTGCTCATGCGTGCGAGCGACATTCCGCTGACAGCGGTCAGAACCCCGAGCGGGATGCTCTGGGAGTGGTTGGTGATGCCCCAGGGGCTGTCGAAT
GCGCCCGCGACGTTCAATCGCCTAGTGACGCAGCTCTTCCGGCCCCATCGGGCGTATGCACAGACATACTTCGACGACATTTTCGTCCACAGTCGTGCCG
AGCACGGGAAGTCAGATGTGGACAACCACATAGACCATTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGCTGTACGCTAACGCATCCAAATGCAT
CTTCGGTGCTGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGCGGCCTTCGAGCGGATCCCTCTAAGGTCAAAGCCATTGTTGACTGGCCGGTT
CCCAAGAACCAAAAAGACTTACGCAAGTGGCTTGGCCTCGCCAACTATTTGCATAAGTACAGCGACAACTACGCTGATATGGCTCGGCCATTGTCCAATC
TCCTTAAGAAGGATGTAGAGTGGGCCTGGGACACCGAGCATCAAGTTGCCTTCGAGGCGGTTAAGGAGAGTCTCCTACACGCGCCGATCCTGGCGTTGCC
AGACCCCGATCGTCCGTTTAGTGTGGTCTGTGACGCATCGGACTTTGCCATCGGTTGTGCACTGCTGCAAGCAGACACCGAAGGGCGTGAATGCGTAATT
GCGTTTGAGTCTCGCCAGCTTAAAGCTGCAGAGAAGAACTATCCAGTCCATGACAAGGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTTC
ACCTGCTAGGCTCTAAGCCATTTGTCATCTTTACTGATCATGCGTCACTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAGAGAATGGCCCGCTGGCT
CTCCTTCTTTGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAACGGGTTAGCGGACGCGCTGTCCCGCAGACCCGACTATGAGTTATCT
CATGCCACGACTGTGACGTCGTCCGTGACGGACTTGATCCGCGCTGCGTATGCGCGTGACGACATGTGTGTCGCTCTACTACGTGCTCTTGGGAGCAAGG
AGTTTGGAGACTCGGACTGTAAGCTGTCGGCGCGCTTACGCGCGAGGCTGCATCGATATTCGCTCGATGATGGCCTGCTGTATTACAGCACAGATCCGGA
GGATACTCCACGTATTGTGGTCCCTCACGATGAGGATCTGAAATATCGTATCCTCTATGAGGCACACGACACTGCGCTTAGTGGCCACCTTGGTCGCGAA
AAGACCTATGGCTCTGTGAGCCTCTCCTATTGGTGGCCCAAGCTTTACAAGTGGACGAGCACGTATGTGCGCACGTGTGAGACGTGTCAGCGGGTGAAGC
CCTCCCCGCATGCGGCCGCGCTGCTGGCAAGCTTGCCTGTACCCTCTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTCGGCCTTCCGAAGGACTC
GGATGGCAACACGGGCATCGTGGTCTTTGTCGACCGTTTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATTGATGGTAAAGGTACAGCCAAG
CTGTTTATCGACCGGATTTTCCGCCAGCACGGGCTGCCCGAGTCGATCGTCTCGGATAGAGACCCCCGTTTCACGGGTAAGTTCTGGTCGTCCGTCTTCA
AGGTGCTGGGCACCAGATTGGATATGTCCACAACGGATCATCCACAGACCGATGGTCAGACCGAGCGCGTTAATCGCGTCGTGGAGGACGTCCTCCGCAG
CGTTTGCGCCGAAACGCCCAAGCGTTGGAGCACCATGCTTCCACTCGTGGAGTTCGCATTGAATAATGCTGTTCATGCCTCCACAGGCTTTACCCCATTC
TACGTGAATGGCCTCACCCACCCTCGCGTCCCGTTGACGCTACCACTCCGTGGTTCCGGGCTTGGTGGGGGAGAGATAGCCGGTCGGCTTGCTGATGTCA
GCCCTCTCACTGTTCGTAAACAGGTCGACGAGTTTCTGTCAACGCGTCTGAGTGTCCTTCGACACGTACGTGACGCTATGGCTGAGAGCCAAGACCAACA
AAAGGAAACGCAGATGCCAGGGGCAGAGGTAACATTGAAAGTTACGCATTAGGAGACTTGGTTTTATTAAACGCAAAAAACCTACCTACACATGCAGTTT
CTGCGGTCTTCAAGACGAAGCTGCGCCCACGCTTCATCGGACCTTTCAAAGTCGTGGCCAAAAAGGGCCTAGCGTATATGCTCAACCTTCCGAAGAAGAC
GCGCACCCATCCGGTGTTTTATGTGGGCTTGATCAAGCCGTACCGGGACCCGGCACGGTTGAGCGCGGAGGCGCTGGCACCAGGACATGCGTAGGTGGCG
CAGCCACAGAACCCTGCTGAAGTCGCAGCAGAAGGTCGACTTGGCCCTCCAGCCTCGCCAGACCTCGCTCAAGGTCGGAGACCCGGTTCGCCAGCGCAGC
TGGGGCCTCGAACCAGTCGACGCGCTCCCGGAGCTGATCAATCTCATGCTATGAGCGCGTTCTCGGCCTGATGGAGAGTCTCACGGAGACGTACGACCTC
CCGGCGCAGCGATCCCATCGCGTTCCAAGCGTCCTCAAGCTCCGAACGATGCACCCAGTGCATCTCAGCGTCCGCCACCGGCGTTGCTCGATGAGCAGGG
AAATTGCCACTTCCACGTGGAACGGATTGTGGCTCGGCGTCGCCGCCAAAATCAATACCAGTATCTGGTGAAGTAGCGAGGGTACCCCCACTCGCAGAAC
TCATGGGAGTTTGAGGTACCCCTCCGGCAAGACTGCCCTGACGTCGTGGACGCTTTTGATCGAAACGATCGACGGCTCCCTGGGGGCTCGCGACCGGCGC
GTCGGTCGCCACCCGCTTCCCGGCAGTAGGTCGAGGAGCGAGGGGGTCAACAGCTGAGCTCAAGCTTTGACCCTGGGCTGCTGCAGCCGACGATCCACCT
TGTGGAAGGTCTGCAGAGCTCGGAGGAGCATGTTGAGGAGCCCGCGCAGGGCGGGGCTGAAAGCCCGAAGGAAGTTGGCGTTTCGCCTTTAACTTCGCGA
ACGCGAACCGGAGCCGACGCTCTAACAGGACGTCGTCCTTCTTGAAGCTAGCTTGCAGGGCGACAATGGAAGAGAGCTTACGAGCCCCTTCCACCCAGAG
CTCGAATTGAGCGACATCCTGCTCCTGGCGTTCGCCAGCCAGTAGGACCACTGGATACGTCCGCATTTGCGGCACGGACGCCCCCCGGGCTTGGAGCTGC
AGGCGCTCACGGTACTCGCGTTGAGTGGTAAGCTGAGGCGTCAGCAACCTTTGGCGGAGGTCTTCTCGCTGAGCGACCTCTTCGTTGGAATGGGCCGCGG
GTCCGATGACATAGTCATTCAACAGTTGCGACGCCGCTAGGCGAGCCACTTCGTTGGGGTCGCGTGGCTCAAAGCCGTAGTCACGGCGGCTCGAGTGGAG
CAGAGGCCGTGCTATCGGACGCTGGGCGCGGGGCGCCTCTTCCATCGCGGCCAGTTGCTGGCTTTGGACCTCGTCGAGGTTGTTGGAGACAACGTTGGCC
TCCATAGGCTCGTCCTCGTCTCGCGACGGGAGTGACGACGTTGTCCGCAACGCGGTCAGAGCTGACACAGTGTCGCTACGTTCTACGAACGGATTGGGCG
TGCGTAGGTCACGCTTATCGGTCGTGCGACCCCGTGGAGGATCCTCCTCCTCTTCCCGGAGGCAGGTATCACTGCCGTAGTCGACCTCCTCTCTCTCTTC
GAGGCCTTCAAAGAGGGTTTCATTCGCGCGGCGAATGCGCGGCTTCGGCGCGTCTGCCGAGCTTTTCGGGGCCGACATAGCGACGCGAGCTTGTTTAAGC
TGCTGCTTGGAGTAATACTCCGCCACAGAGAGCGTGGTTCTCGCCACAGGCGCCGATGCGTTGTGGCCAGCGGCCGAGGAAGCACTACGTGCGGACGTGT
TAGGCGGGCTGTGCCCGGGCGGCGACGACGCGGAGCGTGGGCTGCGGTTGGCACTCAGTGCTGCTGCTTGTCGTGGGCTGTGCCCCGGAGATAAAGACGC
GGAGCGTGGAGTACGGTCAACAGACCAAGAAGCTTTCTGGCTGCCAGCCATCGATGAGCCACGGGCGTGGTGCGCTTGTTGAACTTGGAAAGTTCTTGAG
CGAGGTCCGAAGATCAAGCAGCGATACCTCTGATGAGGGAAAGTGACGAGTGTCGACACGTGGTGTCAACAGTCTGGTGAGGGAGGGTGTAACGGGGTTA
CACGTACCCGTTAGTGTATCGTACACGAATAGTGTGTTTCACACAAATGGTGTGCACACCCAAGTTGGTGTGTGTACACGAGACTTAGGTTGGTGGCCTC
ACAGCCACCCGTCATGCATATTACTAGGCTCCACTATGGTAGATAGTGAGTGTTATACATTTACCCCACTGGCGGCCCTGCCGCGAATAACAACAATAAA
AATCAGTTCACGTTTTGAAGTCTAGTGTCTATTAGCCTTATTTAAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACAGACTGT