Description :
From Genome Similarity Track
Location :
Scaffold_118:47898- 49178
Transcript NameFunction/comments
g6188.t1ETM48080.1 hypothetical protein L914_07341 [Phytophthora parasitica

Sequence
1280 bases(100 bases per row)
CGAGAACCACTACGAAGGCGCGCACGACAACTTTAAGGCGGCGTTCCCCGTCTGGAATGCCTCGCAGGTCCGCACGGGTCTCTATCACGGCGTCTACGGG
GGTGCGGCCGGCTTTACGTACGGCGCCAACAGCGTGTGGCAGATGTACGAGCCACAGGAGGACCTGCTGCGCGAAAGCGATTACTACTCCCCCTCGGCCG
GTCAAAACGCCTCTGGCTCATGGCGTAAGGACGTCTTCTTCGAGGGCGCGACGCAGATCCAGTACGTCACCCAACCGCTGCAGAACCTCTCGACCGAGAT
TCTCGAGCAGCTTGAGCCTGCTCGCCACCTCCTCTCCAGCCCCAACGGCTACCAGGATATCTCTGTCAACGCGTTCGAGGGCACCCGATACATCTCCGTC
CTCGCTTCCGAGACTCGCGACCGCTTCTACGTCTACACTGGCCACGGTGACTCGTTCAGCCTAAAACTTGGCAACGGGTCTGAACAATCGGGTACTGTTC
GCTGGTTTTCTCCTCGCGACGGTCAGTACCACGCCAACTCGACGGTGAGCGTTCCTGCTAGTGGAAATTCCACGGGTGTGGACTTCATCCCTCCTTCGGG
TGGCAGTGTGGACGATGACTGGCTTCTTGTGCTCGAGTTTTAAGTGTTTGATGTCAAAGCTGCCGCCTGCTTTGGATTTTGAATATGAGTCGATTAGCTC
ACCGATATAAGTGTGAGCAATTGGCTTCCAACACCACGCGCTATTAATACATGCAGTACTATATCAAGCCTCGGACTTGCTAATGAAGTGTTCATTCTCA
CTGGATACCCAAGTGTGGGTGGGCGGGGGTACTCCAATGTTGCTATTATAGCTCTCGTGGACACCAACGCACATAACTCTACATAGACGTCATCGAGAAC
TTCGCAGCCAGCAAGGTTACCTCTTTTGAGCCAGCAGAGCTGGCGAATACTTCTTACCGAAGACGTTACTACGTATTCATTGACCGCAAAATAAAGATCT
AAAATTGTGTACACCACGCATTTCATTATAAAATGCCCAAAAGAAGCGCGGCCTCAAAAATGGGTCCCTCCCAAAATCCGGAAGACAATTTGGCAAGAAA
TCTCCGTGAGATTTGAATAATAAGTATAAGAGCAAATGATCCTCTAGGTCGTGATATCCTGAATTGTGATTCACTCCGCGGACAGATACGGAAGCTGTTC
CCAATGACCAACTCTTTACAAAGTCCAAGTATACCTCTACCCTCTCGTTGCAAAATCTGGAATATTACTAATCAAAAGCT