Description :
From Genome Similarity Track
Location :
scaffold_132:47893- 48929
Transcript NameFunction/comments
g4287.t1 conserved hypothetical protein

Sequence
1036 bases(100 bases per row)
CTGATTCTGACTCTGCTGCTGCAACAGCCGGATTCCAAGTGACGGGTTTGGGAACAGCCGGAGCGGTACATAAACGCGGTGGTCTCCGAACTGAATTCCT
TGGACTACGTCCCCGTCTCCTAATCGTCTTCCGCGAAGCGTGCAGCCCGCACTCGAGCATTAGCGCCTCCCACCGCAGCACCCGCCGCAAGCTGCCGCGC
GCCTTCCAGCCTCTCCCTCCCCAGTACGAGCTTATATCCGCTGGCCACCTGCACTCAGCGCCAAAAAAGATCATCCATCCACGCGTCTCATTTGAGGGAA
ACGCCACTCGCCCGTAGCTTCTCATTGTAGAACTCGCCGCGCAAGCCCAAAAGCAAGCGCAGCAGCCAAGCAGGAACCGAATTTACAGGGCAGCAGTAGC
AAGCCCCGTGCGTTTCGAGCACAATAACAGCCTCAGCCTCAGCAACAGGACCTGCAGCAGCAGCGGCGGGCGACAATAACACGATGGGCAAGTGGATTTT
ACAGCGGAGACGCTCGCATGGCGAGCTACCGCGCCTGCACGAGCTGGAGCGTGCCGTGCAGGCGGAGATCCTGGACGTACATGGACGCGAAGAACTCTTC
CTGCGCTCCACATCGGAGCTTACGGTGCTGATGAAGAAGCTCGGCCGCACACAGGGACGCGCTTACTTCCGCTACGTGTTGCGCGACGTCTTCGGCGAGA
AGTCCAGACTGTACGAGGCGCACGGACCGCCCTCGACAAAGCAGGTGTGCGCGTACGCCAAAAGCGTCATCCAGCGACTGGCCAAGGCCATCCACTTCGC
GCCGCTCGTGCTGCGCGCCGGCTGCCACTATATGCTCACCGAGTTCCGGAAGGCTTTTCCGGGGTGCAAGCACGACGCGCGCATCGTTGTGGGCAGCCTG
CTCTTCCTGCGGATAATCTGTCCAGCTCTCATCAAGCCCGAGATGTTCGACTTCCCGACACACACGGCACAGTCGCTCCCCATGGGCGTGCAGATTGCCA
AGATCCTGCAGCACACACTCAGCGGCACGCCCGTAG