Description :
From Genome Similarity Track
Location :
Scaffold_102:47890- 50763
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_102-snap-gene-0.22Vacuolar protein sorting-associated protein
Pytve_DAOMBR484maker-pve_contig_102-fgenesh-gene-0.13ATP-binding Cassette (ABC) Superfamily

Sequence
2873 bases(100 bases per row)
CGGGGACGCTTGGGATCGAAATTTTAGCTGATGGTCCAACGCGAGTGCTTCGTTTCGCGGATACTCGGCTTCGTGGCGAACAAGGCGATAGCAGATTTGT
CAAGCAAGGTGAAGTTCCGTTTGATCAAGAGAAGCATAAAGGGTTTTTGTCGCGATTTGTGGCCGCACCAATGTTGCACACCACGGTTCAGCTGCAAGGT
GTCGGTGTATCTGTGGTGGACAGCCTACCGAAGGAGCTGGTGTACTTCTCCGTGTCCAGTATTGAATTCGAATTGCTGATGAGCGAGGAAGATAAGCAGA
AGGGGGCTGTGTACGCCGAAGATACTGGTGCAGCCATGTCGCGATTAGAGCGAGAGAGTCACGCTCGTATTATCGCATTCAGGCTTCAGGTCGGCGATGT
TCAGATCGACAACCAGCTGCAGGTGACGCCGTACCCGGTGCTGCTTCGCTTCTCCAACCCTTATGGGAGGGGTCGCTTCGTGGACAGCCAGATGGTCAAT
GCTCCAGCGTTGCAACTGACGCTCGTCAAACATGACGAATACGCCGGGATTGACTTCGTTCGCCATTTCAGTGTCAATATGCTCCCGGTTCATGTTCGCG
TGGATGGTTCGTTGCTGTACGAGCTTCTCCCTCTTCTCAACCATGGAGCTCCGTATGGTGGGACGAAGAAGGAAGCCAAGCGAGCTGTTGGTGTGGAGCA
CAGCGGAAACCAATTCAGACATGCGCGGAACCAGTTCTTGCTGCAAGATTACAACTCCAGTTTGGAGGTCCCTGTGCAGATCCTGGAGACAGCCCATAAG
GACAACACTACGTCTGCTGGCCCATCGACGGTACCGACGGCTCCTTCGGTCAGGAAGCCACGTCACCAACGCCGTAAGCGAAGTGGCGTCCCATCGGAAA
TCCAGCGCTATTCTTTGGCTGTGAAGAACTCGAGTCACTCGAAGCGTTCTGCGCACGAAACCAAAAAGCTCTACTTCGAAGAGTTCCGGATCGGTGCAAT
TCGGGTAAGTGCTCGTTCATGTGCACGCTCGTATTCCGTGCTTGTTGTCTGACTGACTGATATGCTTTGTCACGCGCAGGCTACAGTGAGTTTCTCGTTT
GGCGCGAGCGCCGGTGCCATGGTAGACGGCCACATGGCCTCCTTATCCAGTGTCGTGTCCGACTCAACTCGGGAAGGCTCTACCGTGCCGGTGGGTCCCC
TTCGTTTGATCTTGAACGCTATCGGAACGAGCTTGTCGAAGATCGCGAACGCTCCTTTCAGTCTGAAACCCCTGCACATCCACAACTCGTTCGTGCAGCC
GGATGCGCTGGCGACGCGACTCGTGTCACATTACCAGAGCGAGGCTCTTCGCCAAGCGTATGTGATCTTGGGGAGCGTCGATGTGCTGGGAAACCCCATG
ATCGCATGGAGAAATCTGCGCGGCGGCTTCCAAGACTTTATTTACGAGCCTGCGCATGGTATCACTCAGGTACGCAGATCTACATCCTTGCGGACTAGTG
GGTGGGAACCATGTACTAACAATGTCCATACTATGTTGCTTGCAGGGTCCACAAGCGTTTGCCTATGGAATGGGCCGAGGCACACTATCTCTCTTCCGAG
CGTCGGTGTACACTGTACTGGACTTCAACACGCGCATTTTGTCGGCCGTTTCGCTCGGTCTCTCGGAAGCGTGTCTGAAGCTGGATGACTACACGGGGTA
CCCTGCGACACGGAACATTTTCCAAGGCGTTGCTCAGGGCATTTCGGGCATTGTGGTCGCACCGATCCATGCAGTTGAGGTCAATGGCGTCCGTGGTGTG
TTCCCAGGCTTGATGGCTGGTGCGATTGGGTTGGTGCTCAAGCCCATGCTCGGCCTGTCACTCGCTACGGCAACGACGGCTGCAACGCTTCGGGACGTTG
TGGACCCCAACACCAAGGCGTTGCTCGTGCGTGTGCGTCCCCCGCGACACATTGACTTGCGAACCAAGCGGCTCAAGGTGTATTCGTACGTTGAGTCGTT
GGGTGAAGAGATCGTGAGCAAGATCCGCGGCGGACGGTACCGCGCCGACGGATACCTCGGCCACGTCGACCTCAAGCAGAAATGTCTGTTGGTGACCAAG
AAGCGCGTCCTCTTCCTTGATGTGAAGGCGTCGGGCCAAAAGTTCGAGGTCGAGTGGGAGTTGCTCGCAGAGGAAGTCATCATGGTCGACTGCCGCAAGA
CACCCGGCGAGCAGATGGTGACGATTTACTATATCGAAGACGAGTTTAAGAGCAGCAGCGGCGGTCTCCGTCAGCGCACGCCCGGTCTGCCCAAGGGTAT
GCTCATGAAGAAGCACACGGTTGCGCTGCCTGATACCAAGACGCTGTTCGTCCGTGCCATGCTGGAGCAGCAGGAGCGGTCGCTCCTGACCAAGATGAAC
AGCTACAAGACGCCCGACACGGCAGCAAAGCCACCGGTCTCATCGGTCACTAAAGCGGCGACGATGGAGCTCAAATCCTGGCAACAGCACCGCCTGCCGG
CATCGTACCCGATCTTCCGGCTGCCATCGGCGACACAGATCCCGCGGAGCGCGTCCAATTTGTCGCAGGTTTTGCGCGACGAGCAAGTCGAGGACGAGAC
TCATGATTTGCACGAGTGAGGGACTACTCTCGCCAGTTCCCCACATGTTCAGTTTTGGTGTTCATAGAGGATGTATGATCAATGCATGTAGCAGCGATCT
TCTTTGGTCGCTTATCGTGTAGAGTAGACTTTCTAGTGGCGCTATCAATTACTCAAGCAGTCTCTTCATCAGCGTTGTCGCCGCGCGCTGCAATCGCCTC
GGTCTTGCGCTGCACCGCCCACATACGCGCGTAGATGCCATCGTGGATCTGCAAAAGCTCGTCGTGCGTTCCT