Description :
From Genome Similarity Track
Location :
Scaffold_4:478855- 487021
Transcript NameFunction/comments
Physo_315983DNA topoisomerase putative
Physo_503007Hypothetical protein
Physo_502341pleiotropic drug resistance protein ABC superfamily

Sequence
8166 bases(100 bases per row)
GCTTGTGATGGTGCGCTAGCGCGTTGGCCGGTATGCATGTGCCTTGCATACTTCGATAAAAAGAAAATACACTCAAATTCTCGATCAGATTTACGTTCAT
TTCAGAATTTTCCTCGATCGTGCAAGGCGGTCATGCAGCGCTCAAGCGACGCCACAGCAGCAGACCAAGCCAGGTCGGCGAAAAGGAGCCTGACCTTCCC
GTCTGTCTCCATCGGGAAGTACATCTTCTCCAGCGAGAAGCTGCGCCACGTCAACATGCGCTCCTGCAACGATCGAAGCGGAGACCGGGTTGTGGCCTAC
ATCTGCGACCAGTATTGTGCAGAAGTGCACTGGTCGAAAGTGACAGGCACAAAGCGCTACAAGATGACCGAGCAAGTCCAAGGTAATTTTTGGAGCGCTA
CAAGATGACCGAGCAAGTCCAAGGTAATTTTTGGAGCGCTACAAGATGACCGAGCAAGTCCAGGTGATTTTTGGCCAGTTTAGTAAAATATTTTAATTAT
CATAAAATATTAACAAAACTTTTGAAACTGATTTATTTGTATCATAAGTGCCCCACAATTATAATTGTATAGTACTTTATAGTATGACACTACAAATAAT
CTTTCAAAATAAGTATACAAAGTACTGGTGTCACGAGTCCATAAGCTGTAACATCTAGAGGATTCGATATGCAACGTCGAAGAACTTGATGCATTTGATT
TGATCGGTTTTTACCTCACTATCCAGTTATTGTAGGCTACTGTAAGCGTATTAATGCGCAGATCTATCTATCGTCTTCTTATGACCTTTAAGATACCACA
TGACGAGCAATTGAAAACTGAGTGCGATTCGTATTATGATAAGAACAAATGCACTGTTGAAATATGCTTGGCTCGGTAAATGTATTTTCATCTCAACGAT
TTACCAGAATTACTTTCAGTATTTAGGGATAATCTGTTAAGGTTTTTGAAGTGCTTTCGGCTAGTGGGCTATATACCAGCGCCGCTTTGTAGCGATGGGA
CAGCCAATACGCAAAAAGTACCATTTGATTTTCGGCCAATGCCATGTCTCTCAAGGGACGTACGTTCGTCACAAGTCACAATATGATACAGGCGGAAAAC
AACACACTGAAAGTCGAGAAAGAGCAGCTCGCGGTATTGCTTGTTGAAAAATATTGTACAGTGTATTTATTTCTAACTGTTGATATGATGCCACAGGAGG
AAATTCACATTCTGAGAGCCGAGAATGAACATCTCGCGGTAATATTTGCTGAAAAAAATTCTACAGCTTCTGTTTACTAACTCTAGATATGATACAGGAG
AAATATCGCGAGCTAAGTGATAAGTTCGAGCAGATCACGAGCGCTGAGGTAATATTGTTGAACTTCTTGCAGCTTACGTATTTTACTTACCGCCAGTATG
ATCCAGGCGGAGAAATGCAACCAGGTTGAGCAGCTCGCAGGCTTTCAGGTAATTTATTCGTTGAAAATCTGTACCCTTTATTTTATTTCTAACCGTAGAT
GTCTTATACAGGAGGCAATGATATCCCAGAACGAGCAATTCGCGGTACTGATTGTTGAAAATGCTCTACTTTTTCTTTTTACTAACTGTATGATATGATA
CAGGAGCAAAATCGTGTTCTGAAAGAGCAGCTCGCAGACGCTCAGGTACTAGATGTTGGAAAAATTGTACGGTTTCATAGTTTACTAACCGTAATATTTG
ATATCAGTACAACCTGAACGAGAAAGTCAAGCAAGTCGCAGAACTTCAACACAAAACCCAGGAAATTCGCAAATCGAGTCACAACACGATCCAGGTAATG
TTTTCTGCAACCTGGATTTATTTATTTTACTTACCGTAAAAATGTTTTCAGGAACTTCGAGGGAATGTTCGGGTCGTGGTTCGAGCCCGGCCAGCTCAAG
GTTCAGGTGGCATCCTGTCATTTGGAAGCGACGGGGCCCGTTTGACCTTGAGCGAGGGCGATCAGGGCCAGTCGTACGAGTTCGACCGGGTTTTTAGCCC
TTCATCGACCCAAGACCAAGTGTTTGAAGGTTGAAGAGCTTGAAGGGCTGGTCCAATCCGCCATCGACGGGTATAACGTCGCCCTCTTCGCCTATGGACA
GACAGGGGCTGGAAAAACCCACACGGTAAATTTGTATGCATGATTTATTATATTGTCACCAAATGTTCTAAACCCAGTTTGTGTATCAATGTAGATGCTT
GGATCTGACACCGGTCAACAGCGCGGGGTAATTCCGCGTGCGCTGGAGAAGATTTTTCAAGAGACTTCGGTTTTGACCGAAACTGGCTGGACGTTCAAGG
TTCAAGTGTCCGCCGTCCAAGTTTTCAAGGAGGAGGTGCACGACTTGCTCTGCACCGGCGAGCTTGTGAATCTGAGGCTGATCGAGAGCAAGACCAGCCA
CCAAGTCGCTGTCCAGGGGTTAACCACCTCGCAGGTACGTTCCAGTGTGGAGGCCCTAGATCTGCTCACTCGAGCAACCGGGCGCCGCAACACTGCGAGC
ACGGCGATGAATCAGTCATCGTCGCGCTTGCACTTCGTTTTCATGGTGCGAGCCGTGGGGTCAAACCCCGACCGCCATGACAGCGTTGATGGGCTGCTCT
ATCTGGTCGACCTCGCGGGCAGCGAAAACGCTGGCCGCTTCCAGGTCTCCGGTGAGCGGCTTAAGGAAACGAAGGCAATCAACAAAAGCCTTTGTGCCCT
CAGCAGTTTTCAACGCCATCGCCCATGGCCAGCAACATGTACGTGCATCTCATTTTTTATTTTACTGACTTCGGCTGAATTTCTAATCCGTGTTTTGTAT
GTTTACTTCTACTGTAGGTTCCTTATCGGAACTCGAGGTTGACGCGCCTGCTGGAACCGTGCCTCTCGAATGGAGGCAAGGTGCAACTGGTTGTCAACCT
CTCAGCAGATGCTGAGTCTGCTCGCGAGACCTCGCAGTCTCTGCGCTTCGCGGCAACCGCCAAGTCCTGCGCCCTCGGGTAGTCGAGGAAGCGCCGTCAC
CATGAAGCGTAGTCGTAGCAACAAGAAACTAGCTAGCCAAGCAACAAGAGCAATCAAATTATATGTTTCCATTCATTACTTCAAGTTTTACCCCTCTTGA
CCTTGACGGAATCGTGTCGCGGGACTTGCGCGCAGTCTTCAGCGAGTCAAACGCGATGTGGGCGACATCGCCCGTCCAAGCGGTACCGATTCCGGGCATG
CTGCAATATTTGCACAACGAATCTGCGCTCGAGCAGATTCCAGCTGGTGTTCTCGTCAAGGCAGCGGAGAATGGGCACTTGGATGTGGTGCGCTGGGTTA
TTGACTGTGACTGGGACGAAGAGGAAAACGAGGAAGATGGCGGTGACGAGGACTATTTCGATACGCCGTACCTGACTTCGCTCGGTGGTGAAGCAAGTCT
TGCCATTCACGCTGCGGCAACGAACGGCCATCTTGATGTTGCGAAGTACCTCCACGCTCGAGTTGAGTTGACTGGCCGATGGATTACAAGGAACAAGAGC
TGAGTTCCAAGCGTCAGACCATCAGCCTCGAAGCAGGTACTCGGCGACGACCACCCAGCGGCGCCAATTTCGAGCGACACGATGCTGACAGCCGTGAGAA
AGGGGTTGGCGGAGGTGGTGAAGTGACTCTGCCTTGAGTTTAGCTGCAACGACACGATTGATCTCTTCCTGCCATCGCATGGAAATGGTTCAGCGATACA
TGTGATGGACGAAGCTGCAGCCTACGGACATTTGGAGATCGTGAAACACTTTCACGAAATTGCATCAGCGCTCAAGGCCGAGTTCTCAAGGAGCGAGCGG
ATACTGCAGCGGAAAAGGTGACGGGTGCGATGTTTGAGCAGAAGCGCAATCGCCACGGCATTCAATGCACGACAGCAGCGATGGATGGAGCAGCAGCCAA
CAATCACCTGGAAGTCGTCAAGTGGCTGCACGAAAATCGGTCCGAGGGATCCACAACCGATGCGCTGGACCGCGCAGCTGGAAATGGCCACATCGAGGTG
GTCCAGTGGCTGCACGCTCATCGGGCTGAGGGTTGCACCACAATTGCCATGGATGCAGCGGCCATCTTGGCGTCGTGAAGTGGCTCCATGAGCACGCAAC
TGAAGGGTGCCCTACACAAGCGATGGACACCGCAGCGGCGTCCGGTCACCTGAGGTTGGTCAAGTGGTTGCAAGACAACAGGCTGCACGAAGGACGCAAT
GAATGGTGCAGCTGAGAACGGGTTGTAAAGTGGCTCCACGAGAATCGCAGTGAAGGGTGCACGGAAGCGGCTATGAATTTAGCCGCAGGAAGTGGAAAGC
TTGAGTGGTGAAATTTCTCCATCGGTATCGAAGCGAGGGCTGTACAGTACACAGGACGCTATGATTGGGGCTGCGAGAGGTGACCACGTTCGAGTCATTG
AATGGCTGCATGTGAATTGCCCCGACGATTGTTCAGGTCCAGCTATTGATGAGGTCACTGCACGGCGCTTGAGGCTACGCTGTTCCTCCACCTGGTTCGG
AATGAAACGATGAGCCCAGAGGTCATCTCGAATTCCATGGTGAAACATCACCTGGGCATTGGCCACTTCATTGTGGATAACATGCCATGATCGGTGGTAT
AACTCGAGCTGGATACGGTTCTTTTTAAGCGATGGGGACACTCAGAAAGCTAACGGATATCTACTATATTTTATTCTTGTTGCGGTACAAGGTTCGCAAC
GTCGCAATGTTTGAATGAAGCAATTCGCGCTGCATGAATTGCCGAGACGAAACTTGATTGAATCGATACACTTACCAGATTCTTTCAGCTTTGAAACTAA
GCTGAAGTAGCAGCGGACCAACCAGATGTCGAGCAGTGAAGTGCCAAGCCGCTTGAGTCCTGTTGAGTCGAATTGAGAACTGATTGATTGAATGAAGTTA
CTCCTGGCATCTCCTAGCAGCTAGACTACTCATGTAGCGCCTTGAAGACACCCTGTGTACCCAAAGCAAGGGTTCAAACGAACCCAGAACGAAACTCAGA
TGAAGTCAACCCTTACGCCAGGGAGAACAGGCGCTAGTGTCGACAGGGTGCAGAAGGAGTTGTCAGAAGACTGTGGTCGCCATGACACGGCGGCCCACCT
CCGGCAATACCCGCGTGCTTTCGTTTCCGCTCGTGCCTTCCAGTTGCTTGCTATAGACTATAGCCATGACTTGATAAGGTTTTGCTGTCCAGTCAGGAGC
TGCAGTGCCGACTAGCGTCGTGGGCAGTCCCTTAAAGATGTCACGAGTCCGAAGGAGGACCAGAGCAACCGTCATCCGCTGCATTGAGCTGCTGCGGGCT
CTTCGAAAAAGCAGAGCCGAAGACTACGCGCAGATGGCGAAGGCAGCTAGAAGGTTACTTCTGGTTCGATATCGTTTTGGCATTTCGGTTCGCGTGGAAA
CACTGAATGTCCGGTATCCCGCTCGAACGTGAAGGACTGCGAACAGCGCTAGCCTTACCAGCAAGTGTCACCGTAGTATATCGGCGTAATGGACTGCTAG
GAGCTCGTGGCGTTGTTTGGCCAGCAATCCCTGCTGCAGGACCACCAGTAGGTGCGTTCACGAGTAAATTACGTAATATATGAGTCTATGTTCAGATGTG
TGATGAAATTTACGCCGAATTCTTCCACCAAGTAGGAAGAATCTTCCTGGAAGATGGAGCGGCGCGGCGTGGGCAAGCGGCTCACCGACGGCCAGCGCGT
GGAGATCCTCAAGCTGCTCGACAGCGGCGCCCTCGTGAGCGAGGCCGACGTGGCGCGGCGCTACGGGGTCACGCGCTCGGCCATCTGGCGCTTGCGGCGA
TCAGGCCGCCGCATTCTCGAGCGCTACCAAGAGGGCGACCTCCAATCTCGGAACGAGCGGCGCCGCGGCTCCAGGCCCAACCACAGCAGCGGCAGCAGCA
GCGACGCCCAGTCAATGCAAGCGCTCGGGGCGGCCGGGCCAGCGCCAGTGCCAATAGCAGCAGCAGCAGCAGCAGCAGCGCCCGCGATGCATCCAGCCAG
CTCGATCCGGCCGATCCCGGCCCCCGCCCAAGTGACGGCCGACTGCCGGCCACAGCCACAGCAGACGCCGCGACATCAGCAGCAGCAGCAACCGGTCCAG
AGTCTGGAGTCCATGGCGCCGCTCGTGTTCATGGCGGCCAAGGCCATCGGCAGCGTCCAGTCGCCCGGCGTCGTCAACTGGGAGCGCGTCAGCGGCCACG
AGGACGAGGACTTCTTCGAGGTCGTGAACGACGGCGTCTCCGTGCTGCAGCCGGGCACGTACCAGATCAACGTGGACCTGCAGCACAGCCAGCCGAGGGT
GAACTACAAGTTCGTCTTCAAGGTCTGGCACGGTAAGACGCTGCTGGGCCAGTGCTCGACCCCGCTGAGGACCAAGAAGGAGGTCTCACTGAGCCTGCTG
GAGATGAGGTGTCAGCTGCCGGCGCTGGCCAAGCTGCGCGTGGAGTTCCTGGCGCCCGGGTTCGCCTTCCACGACAGTCGCATCGTGCTGCGCCTTGTGC
AGTAGCTCCAGAGGCTGTCGACGGTGGTCAAGTGCCCGAAGGTGAGTGTGGTGCAACGCATTTTTTATTGTGTTGATGTATGTGAATGTAACGGGAATTG
ACGCGCTAACGGGTTTACCGCTGCTGGTGGTTGATGTAGCGCATGGCCAGCGCCGTGAGCACGCGGAAGAACACGATCATCCCGACCATGATGCCGAAAT
ACTGGGCCACGTGCGCGTTCTTGATGCCGAAGACAGCCTCGACGTACGTCTGCACTGGGATCTCTCCGACTGTGGCAGGCGCGTTCTGCACGATCTGGCA
GCCGTGCGGGTAGTCGGACATGTCGAGCGGCGCGATGCCGCCCGGACTGGCGCTTGCCACCATGATGTTCACGAGCTGCTTGTTGGAGCACTTGCCGAAG
GCGATGGCTGCGAGCGCAGAGAACGAGTAGCGCAACGGCGCGATCGCGTAGAGCCACTTGTAGCCCTGAGGGATCTGCATCGCCGGAGGGTTGAAGCCCA
TGACCAGGAGGCAGATGGCGTTGAACAAGATGCCGATCACTGCGGCGACCTCGATGCTGGGCAGCGCGAAGACCAGCAGTTGGCCCATGTACGCTTGGAA
GAGGATCATCAGAGCCACGTTGATCCAGTACACGACTCCGTTGACGAAGCCCTCCAGCCCAACCATGGGGTAGTAGATGACCGTGAACAGCGCGGCGCCG
ACGAACACGTACGGGAGCTCGACGATCGTGAAGCTGACGAAGTACCAGAGAGCAGAGTAAGTTTGTGATGCGCGCTCTCGATAGAATGCGGCTCGCTCCT
CGAACGCCATAGGCAGAATGCTGATGAAGGACACCCCAATGAAGACCGTCGAAATGAAGACCATGCCAAGCCCGCTATTGATGCCCTGGTAGGTTTTGAA
CTCTGCGCTGATGTACACCAAGCCGAAGACCAAGCCGAGGAAGATTGAGATGCAGAGCCGAGTCAAGTTGTACGATGGAGTGTGCCAGTACATGGTGAAG
AAGCGATCAAGAAGGAAGCGGAGCTGCGTGGCGCTGGACGCCGCACGCTTCTTGGAGTAGCTCACCGGCTTTAAGTGGTCGGACGACTGGAACAGACCAG
CTTCGGTCATCTTGCCATCGAGAGACTTCTTGTTTGCGCTGGCATGGAAATACTTGACGAAATCAATGGGCTGCTGGTCTTCATTTGCCTGGCCGACTTG
GCGTTGGCTTGCGACACCTGCACCGATGACTTCCAGCATCCATGTGGCGGGGTTGTATCCGTCCGTGATTCGCTGCACACTCGGAATGGCTTCAAAATAG
TTGATTAGGGCACTGCATTCGTGCCCCAGGTCGCCGAAGTACACCGTCTCGCCGCCGCGCTTGAGGAGCAGAAGACTATCGAACAAGTGGAACACATCGG
TAGACGGCTGATGGATGGTGCACAGCACCGTACGTCCCGAGTCTGCCACCTTTCGGACTCCGTCCATGATGACCTTGGCAGATCTCGCGTCAAGTCCACT
GGTGGGTTCGTCCAAGAAGAGGATACTCGGCTGCGCAGCCATCTCGACACCGATCGTGAGGCGCTTCATTTTCTCCATGGAGCTGCCTCGGATCATCTGG
TCCGCGATTTCTTCAAGGCCAAGCAGCTCGAGACACTCATCAACAGTGTCGAATTTGCGGCTGTCG