Description :
From Genome Similarity Track
Location :
Scaffold_332:4788- 6371
Transcript NameFunction/comments
Phyta_totarag7220hypothetical protein PHYSODRAFT_332788
Phyta_totarag7221hypothetical protein

Sequence
1583 bases(100 bases per row)
TCCAAGGTGTTGGCACCGGCCTGACGCCAAAATCCTATGATGGAGACGTGTCCTCGAATTCGGTTTGGGAGCTCAAGTGTCTGTGGAAAGCTAACGgagt
ggaggaggtggtATCCAAGACGTTCGCCGTTTTGAGCCGTGACGAAGCCTGTTCCTTCCAAATACACGTAGTCTCGGTTCTTGACGAGACTCGTGGACGC
AAAGGGGATGTCGAGCTCCATCCACTTTACGATGAGAGACTGGAACGGATCTTCGAGCGTTGGGAGGACGATGGGGTCCAGGACGGCCGCGCCGCTAACG
TCGTCCACGTATGAGGCCTTCACACGCATGGTCTCCAAATCTTCGCTTAAAACGCCGTACATGAGGTCCTCGAGCTTGCCCTCGATACTTCCGACACACA
GAATCATCGGAAGACCAGAACCGGACGGTTCGCTGCCTGCGGTGTGGGCGGACTCGGGTCGTTCCGCGTATACGGTGAGCTTCTCACGCTCCTTGATCTG
CTTCCAGCGACGAGAATCAACCTTCCGCTTGCCCGACGAGACGAACGTGTTGTAATTGTCGAGGTTGGTCATAATGATGCTATTGGCGAGGTCTTGCAGC
TCAAGGCGGTCGTCAGGGTGGATTTTCATCTCCGAGAACGGGTTCACGATGAAGCGCCCCTTGCCCATTCTGCCCGGAGAGTCTGAAGAAGTTTGGTGTT
GGTCGTGAGAGAGCTAGAACGGAAGTGGCCATCTCGTTTGGTGCATTCTCCAATACTCAGGTTGCGAAGCTCTGCCAAGACTCATTTTGCGTGTTGATTC
GGACCACCTGCTATGGATaggaccaagaagctgttAGACCATCACGATCTTATCCATACCAGTTGATTGCCTTTTCACGGATTCGGATAATTCATCATGC
CAAAAAACTGAATGCGAGCCCGTGTGGAGTTGACGTACTCAAGTTCTGCAAAGGTTTTTTTACTACGAGCACCCGGAAATTGTCTCGGCAAGAATCGAAA
ATGATTCGGTTGAGCAATTTGTACATCTGAAGAAACTTTCTGACCTATTAATAGTGCGGTCACCGAAATGATAAACATAAATGAAAATTGATTCTTGACT
GAAGATGTAGCTTTTATGTTAAAAGTGCTGGAGAGTAGGAACTAAGCTATACTTCAAAGTAGTAGCCATGAACTCGCAAAGTGCTCGGGTAACATATTTT
ATTTACCTATGAAAAAGAAAGAGTTCTACAAAATTTACTCTATCACATCAGTCACTAGCGGTTAGACTCTAGTGAATGGAGCCCTCAGACATTGAGCTGG
CTGTGGACGCGTTGGACAGGAACTGAAAGCTCTTCGATCCTCCTCCAGCCGCGAGAATGTgagctcgtgctgcttccGAGGATGGTGTCTTCATCGCTTC
ATTCACACAAACTGCGCAGAACGTGACCTTCCGTTGGGCCAGTAGCAAATCTGGTGTCACGAagctcagcttcttggaGATCTTGCAGTTGTGGCAAACG
TGGCCGAAGCAGAGTTTGCAAGTACTGTTGCTTTTGCCGAAGTCTCCGATCCTCCGACTAGTGATCGGACGCGCGCAAGTAAC