Description :
From Genome Similarity Track
Location :
Scaffold_5:478693- 481075
Transcript NameFunction/comments
Phyci_490956Hypothetical protein
Phyci_76668exocyst complex component 4, putative

Sequence
2382 bases(100 bases per row)
GAGACGCCGCCAGGCATCCGCCAGCAGTATGCGAGTCCGCCGCGCGAGTCGCCCGAGCAGCGGCGGCGGCGGCTGGCCAACCGGCGCGCGGCCAAGTACC
GGCACTTCCGCGCGCAGAACGCGGCGGACCCAGCGGCGGAGCGCCAGCGCCTGGCGAACACGCGCCGCCAGCGGGAGCGGCGCTCGCTGCTAGACGCCGA
GGCGCGCGAGCGCCTGCGCGCGCAGAACCGGCAGCGGCAGCAGCAGCGGCGCCAGGGCCTGAGCGACCGCGCCAAGGCGGAGATCCGCCAGAAGCAGCGC
CAGCGGCAGCGCCAGCGCCGCCAGACGCTGGACGCCGAGGCGCGCGAGGAGCTGCGCGAGCGCGAGCGCCTGCGCGTCCGTCGGCGGCGCCGAAACCTCA
GACAGCAGCAGCAGCAGGAAGAGGAGACGGAGGAGGAGCAGGCGGCCGCGCTGCCCTCCGCGCGGCAGCTGCAGCTCCCGCCCAGCCTGGAGCGAGAGCG
CCTGCCGCAGCTGAGGCTCGCGCCGGAGCTGCCGACGCTCAGGCAGCACCAGGAGCAGCAGAGGCAGCGCGAGATGCAGAGCAGGCTGCCGTTCGGCGGC
GGCGTGCAGATCACGCTGCCGCCGCCGCCGCCCATGGAGCGGGTCCTGCCCTTCGCGCACGAGCGGATCCCGCCCTTGCCGCACCTGCAGCAGGTGACGC
GGCCGAGCGCGTCGCTGCTGCTCGCGACGCCGCCGCCGCTGTTCCCGATGCCCGGGCCACTGGCCGCGGCCAGTGGAGGAGGACCCACGTCGGCGGGGCT
GCCCACCGTGGCCAGTGCAGTGGCGGCGGCCGCGACCAGGCCGCCGCACCCGACGCCCATCATGCCGTCCGTCAGCCTGCCACTGCCCAGTAAGCCCCTG
GCGGCGCTGCCCATAGTGCCGCAGCAGCAACAGCAGCCGCCGAGGACGCCCATTGTGCTCCCGCCAGCACATCGCTCGCTCCCGCCTCTGCCCGACTTTC
TCAACAGCAGAGAGGCGTTCAATCCCGCTACCGCCGCCGCTGCCGCGGCGACTACTACAGCGCGCTCGGCGCGGCCTTCGAGCAGCGCTAGTAGAGCGCT
GTTCCCGTCGATTACTGATTTACCCACTACTCACACGGAGACACAAGACTCGGACTCATTTTTCCAACGATGAGAAGGTCGTTGACGACGAGACGCGAAA
TGCATGGTACATAAGATGCAGACGGATGCAATTCTTGCATTGCGCTGTGGACGCTATTGTTGCTCTACCGCAGCAAGCTGTCAAGCTTGTTGACACTTCC
TTTTGCAAGTGGACGATGAGGGGCATCGACGTGCCAGAGCGCTCGAAAAGCTTCGTGGGTGTACGCGCCCCGGTTTGCCAGCAGGAACATCTCAAGCTGT
GTCTCGGACAAGTTGAGTAGCTGGTAATAACGCTTGGCGTGCTCCAGTCGTGAGGCCGACGAACACGACGAAGGCATCGAAGCAGATGAAGACAGGGATA
GACCTTCGCGCGGGTACGAATAGAGCGTCCCCGTGAGCCCTTGGCGCAGTGCACCAATGTTGAGCAGCATTTGCTGGACACCTCCACGAGTAAATGTGCA
GTCGGTCATCTGCGCAAGGTTGCCTATCAGTAGGCGCGACAGCAGGGCGTCCACACCATTGTAGACAAGGGCCATCTTGTCGCTCGCCAGATACGGTTGA
AGCGCGTTTTCGATCGAAGAGAGGTTGAGGTTGAGCGTGAGGACGCTGTCCTGAGCCATGGTCGGCTGGCCTTCTTCCATGTCAAATCGCTGCGAGACGA
GTTGCGTGAGATAGTAGCAGCAGTGCAGTCTAATCTCACGACGCAGGAAGAGAAGACACTCATCCGCTAGTGCGCTGCACTGCCAACTCGCTGCTTGAAG
CGCCATCATCAGAGCAGGCGAGGTAACAGGAGAAGCTGGACCATTGTTGGACTTCCCTTCAGAACTACCGGCAACACGTTGAAGGTAGAGAGCAATGAGG
TCGCACGCACTGTTAGCGTAGCCAAGCATGCCGATCCGCGCGTTATCCATGAGCAGGCCATTTGCTCCGTGCATCCATGCATCCGGATCGTAGAGATCGC
TCTCGAGCTCAAGTTCCCTTGCCGTGATTACCTCCTCGGCGCTGGTTTGAGTGCCTGCACCGATGCCCATTGATCCTGTCGGCTGCACCTTCGAGTGATG
ATACGGAATTGGGCTTCCTTGCTTCGCCTGTTGATAGCCTTCGTACTCGTGGAAAATGGATGCCAAGTCGGCATACGTGACATTCTTGGTTTGCAGTTGC
TGGTGATTCAATGTTTGCTCTCGGATATCGCGCACAATCACTGCGCATTCCTCCAGCCAGCTCAAGACCGAGGCTTCCAACA