Description :
From Genome Similarity Track
Location :
contig_9:478629- 480207
Transcript NameFunction/comments
g2267.t1hypothetical protein AM587_10005495

Sequence
1578 bases(100 bases per row)
ACCTCGAAGGCGGCGCTCTGCGTGAAGGTGGAACTCCCAGCCTGACGGACAGGGACAGCATTGGCCTGCTTTTCCAGTACGCCGCCGTTGGAATCAACTA
CGGCCTGCTGCCGGCCACCGTGTACCCGTTCCTGCAGCAGTACCTGAACGCTACGGGCTCGCAGGTCACCACGGCTTCGACTCTTGTTATCCTGCCGTGG
AGTTTCAAGGTCTTTTACGGCATCCTGTCGGACTGCGTGCCGATCTTCGGCTACCGTCGTAAGATCTGGATGCTCATCGGTTGGGGCATGTGTCTTATCA
TGCTTATCGTGATGGCGGCCTCTCCGGCTGGCAACCCGTACTACACGGTTCCGTCAGACCGTGACATTGATCCCGCCGATTACACGCCTGAGATCGAGGC
TCGCATCAACTACGACGCGGGTAACCAGGCCGGCAAGTACGTCATGCTCATGTTCTTTGCCGCTATCGGATACGTCCTGGCGGATGTCTGCGCCGACAGT
ATCGTGGTCGACTACGCGCAGCGTGAGCCCATTGAGCAGCGTGGCAAGACCCAGTCGGCCATTTACGCGGTGCGCACAGTGTTCGTCATCCTTGGCCAGC
TTCTGGTCGGTTTCTGCTTCAATGGTGAAGAGTACGGAGGTCAGTTCAACTTCTCCTTGAACTTCCCCGAGTTGATGTCCATTGTGGCGGTCATCACTGC
ACCGATCATCCCCATCACGTGGTTCTTTATCAAGGAAGAGAAGGCGGGAGGGTTCCGTTCGGCGTGTACATGAATGAGTTGTGGAAGCTCATTCAGAAGC
GTGCGGTCTACCAGGTCGTCTTCTACCAGTTCTTCCAGAACGTTTTCTCCAGCATCTCGTACACGGCCAGTTCTCCCGTTCAATCGTACATGGTGGGCGT
GACCCCGATCAACAACACCATCAGTGAGATTTTCAGCAACGTGCTCTTCATGGCTGGCATCATGGCCACTTCCAAATGGGGACTGCACTGGAGCTGGCGC
AAGATGATCCTCTTCACGGGTATTTTCGTGATCATCGTGGACGGCTTCACGACCTTCTTGACGCTCTGGGACGTGTTCCGCAGCCAGTGGTTCTGGCTCG
GTCTGCCCATGGCTGTGCAGCTCCCGTACGGCGTCGGGTGGATGATTGGCAACTTCGTCATCGTCGAGCTGTCTGGAGTCGGAAACGAAGGCGCCATCTA
CGGTCTCATCACTATGGTTGGAAACCTGGCGTCTCCGTTCGCCCAGGCCCTAACGCTTGTGATCGACCAGCCATTCAACCTGACTACGGAGCGTATCCAG
GCCGACGACAACTCGATCCGTACGGACCTCACGTACGCAGTGCTGATCATGTACGGCATGACGATCTTCTCGTGGTCGTTCCTGATGTTCCTGCCGCGTC
AGAAGGAGGAGACGCAGGAGCTCCTGCGCACGGGTGGCAGCAGCAAGATTCTGGTGGTATCACGGTCTTCTATGTCACCTTCGCCTTCATTTGGTCGCTG
ATGACCAACATCATGGCCATGTACGAGTCCACCTCGTGCCTTGTCATCGCTGGCGGCAAGGGCTGCTAAGTGTCATTC