Description :
From Genome Similarity Track
Location :
Scaffold_488:4785- 7662
Sequence
2877 bases(100 bases per row)
TTGAGTCGGCCCGCGTAGAAGATTGAATTTAGACGCTTAGATGTAGGTACATCCAGCGCGTAGGCATCACCATGCACTCTGATAATCTTAAAACGGACCA
ATATACCGCGGAGAAAATGTGTTCGAACCGAGGTTCGAAAATGAACGCGTCTTGGATACCTGCTGTCGATAGCAGGACAGAATCGCCAACCTTAAAATTC
TCAAGGCTCTTGCGCCCACGTTGGTCAGCTGCAGACTTTTGGTTGTCGACCGCAGAGGCGTTAGCGTCGCGCGCAAACCACGCGATAGATTGACGTTCTT
CCACAAATGCTTCACTTGCTTTAGAGTCGGACAACAGGGGTGTGTAGTGACGGAGTCTCATCACCGGGCATCGCTTCGATGCTCGCGCCTGGTCGCAAGA
ACAAGATTAATGCACGAAGTTCGAAAGTGGACTCGGCCATTTGCCGAGTCGCGTCAACGCAGACTGGTGTATTCTCGCGCTGTTTCGCAGCGCAAGTCTG
CGCATCGTGTACCGAGTCATCCTGTACCAGATTCGAAGCCTTTGCTGACACTGATTATGCTGGCGCCCCACAACAAGAGAAGAGGAACCGGTCAAGCGTA
GGAAAACCGGAACACGTGGATGATGCTCATTGTTCACGTAGAGCGATGTTAATCTTGTCGAAGCGTGAATAGCGTTGTTGAGAGAGAATTCGGTCATGGG
GAGTAATGCGCTCCATGACGAAAACGACGGCGCGTAGCTGCACAGCACATCCTACAACATGCGATTGACTTGCTCTGTCAGATCGTCTGTAGAAGTGTGA
GCGGTGGTGGGCTCAGAAGATGGGTACCGAGAATCTCGAACAGCCGCGATCAGAAAGCGGCTAGCCCCTGTGAAGCGGCCGGTACGCCAAACAAATAGTC
CAATGTCACGGAAATCCATACCTCCGTGGCGATAGTCATTGGACAAAGCGGAGCCTGTGAAGACGGTGCAGGGTTTACGCGCTGGCACACTTCACACGAG
CGTGTCCACTTTTGCGGAACCTATTGAACATGTGGGGTGAGTAAGAATCCTGGGACAGCGCGACATAGATTTTCTCGTGACCCAGGTAACTGCCTGTCGC
ACTGTAGTGGTGTTTGTGGATAACATGACCACGAAGATCATCGTCGCGAGAAACGACGATGGGAGGAGAGTCAAACCGACCACTTTGGTACGTGAGAAAC
GTGACTTTCTAATTGTCGCGCGATCTACGCGCAACTTGATGCCGGGAGTGACTGCAATGCTTCGTCCGATGGATTTCAACAGTAACGGATGATTGAAGAA
AGGAAATCATCGCGGGATTATGCTTCCGCAATGTCAACGCGTAGCGGATTGAACGCAGAAATGGTCGATCCATTGAAGCCAAGCGTGACACAGCAGCACA
ATTATCATCAGCTGATTCCGCTGTGCCAAAAATCGGAGAATCTGCCCTAGGATCATGATCGGGATGACGCGACAAAGCATCGTCGATGACTTTCGTTGAT
CTCAGTTTGTAATGAACCATAAATTTGTACTCAGCAAAAAGCGACAACCAGCGCTCCATGCACTGGCTAATATACGAACTTTTCGTCGCCGTTCGCAGAG
ATGCATGATCTGTGTAGATATCAAACATCTGATCCCTTAGTTAATACACACGAACCTTTACGAGTGCATAGCGCATCGCCAGCAGATCCATATCGTAAAC
AGGATAAGTACTCTCGGCAGGTTGTAGCTGCCGAGATTAATAGCTCACCACGCGATCTATGTCTTTGTCATCATGCTACATGACGCGCAACCTATCGCAA
AGTCACTTGCGTCACACACGACGTGGAATGAAGGTCGCGATTTGGCAGCGCAAGCACGGGCGCTGTCCAAAATCTCGTCTTGATTTCATCGAACTCATCT
TGGTGCTCCTGACGCCATTGCAACGTGGCGTCCTTCTTCAACAATTGTGACAGTGGATATATCACTGCAGCGAGTTCCTTTGCGTAGTGATGCAGGATAT
TCGCCAGACCGAACCATTAACGAAGATGTTTTGGTCCTATGGGACAGGCCATGAAAATTCGGTGATACCTTATCCTGCGCGAACTCCCTTCGCGCTTTAA
AGATTCCCAACACTGGAACTTTGGGAGCACAAAACATACACTTTTAAATTAGCGGACAGGTTGTGCTCACGCATCGCCTAGAAAACCTTTCAAAGGTGAC
CAAAATGCACTGTTAAATCTATCGCGCCCGTCGCGGCGCGACGATACATGAAAATGTCGTCGAAACAACTTGGCGCAAAATCATGAAATCGTTGAAGTAC
ATGGGAATAGATGTGATTGAAAGAAGCAGGGACATTTTTCAGTCTTCGCGGCATCACGGGACACGCCCATTGCATGCTGCTAGGCGTGGTGATCGCAGTA
AGCGGCATCTTCAGGCCGCATGAGGATTTGATAAAAACCGTCCGTTGGATCCAAGGACGAAAAAATCGTGCTTCCCTACGTAGGTATCCAATACCATGGG
CTTCCGTGAAATCGGTTTTTAAGCCGGAATAGTCGCTTCGTTCAGCTTGGTAAACGCATGAGAAATGCGCCTAGCACTTCTAGCCATTTTGACACAGAAG
GTAGGGCTGGAATGGGGAAACGTGTTCTTACGCACATGCCCGGCTTTTCGACGACCTTTAAAGAAGGCGTGAATGGCCTCACCTTGATCACGAGGAAGTG
GCCATTGTTGCTTGACACAGCACTTGGAGCCCAGCACGAGATCAATCTCGTGCCTCACGCCTGATATGGTGTCAGGAAAGACCTTACCAAACTCGCGCGA
AAGTACGAGAAAGGAATATTTCTGCGTGACGAGTTCCTCCCATGATTTTGCCGCGAAGAGCTCTCGTGCGGACTTCG