Description :
From Genome Similarity Track
Location :
Scaffold_196:47840- 53285
Sequence
5445 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCAAAAAACCCGTTCAACATGAACATGTTGGGCGATGAAGGCGACGACACCTTTCACGGTA
GTTAATCCTATTTGAGTTGTCGAATGGAATGCGGTCAAACGAATGAGTTCGACCGTTGGCGAAGAAGCTGTCTGGTCTCTGCCATCCTCAAGGAATAGGG
ACCAACAGCATTCCGTAATCGCCAAGTTCTTGCACGAGAACTTGACGCGTCGCGAGCTGAAGTGACCCTGCTGCATCAGCACGGTCACCGGATGACTGAT
CTCCTGAGACAGCAACAGTCTCAGTCTGCTACTTCAGCGTCGACACATGAGCGTCGACGCGGGACTCTAACGTTAGAAGTCTCCAAGTACCAGGGAGTCG
AGGAAGATTCCCTGTTGAGATGGTTCCTCGAAGGGAACGATGCCATTAGGGCTCGCCACATCGACGACGAGGAAATGCAAGTTGCATTTGCGAAATCGAA
TTTGTCAGGGCGTGCCAGAACTTGGGCCTTGAATCTCCGATTACACGATCTAAATGTGCTTGGATCGTTGGCGGGCTTTAAGGCTCTGCTCATCCAAACG
TTTACGCCACCAAGAGCTGAGTTTAGGACTCTTACAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTTAGCGCGTTCGTTACC
TTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCAAGATATTCTTACAGGGCCTCATAGATGGTCCCATGAGGAACCACCTATTCCA
CATCGAGTCGAAGTCGCTTGAGGAAGCGATTAAAACTGCGGTGCAAGAGGACTTCAGTGTGAGACAGGCTCACACTAGCGTGACCCCCCATACTTCTTCG
AGACAAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGTGTTGAGAGCGAGAGACCTCGTTCTTCAAACAGTAAGAGATTGCAAAAGTGCAATC
GCTGTCAGATGTTAGGACACTACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCAACCGTCTGTCAAGAAGGGCAG
CGGACGCGGTTCCGACGTTGTTGCGAACCGTCCAAAAACGTTCGGGGTCAGTAGGGGCGGAGCGCCCTACTGATCCAGCAACCTCAACAGAATTTGCAAA
CCTATTGATGAAAGTTGCTCCAGACTCACAATCCTTGTATGTCTCTGCACTTGTGATGATGTACTCCTCATCACCTTGAATTTAGAAGTGACAAACTTCG
TGCCTTAGTTGACTGTGGGGCGTCGAACAACTTTGTTCGTCACCAGTCGCTAGAGGATCGTAGGCTCAAGTTCGTTGAGTGCGTTACTCCTCCTATGAGG
TTGACGGTGCGCCTCTTAACAGGCGCATCGATAGCAGTGATGAAACGCGTAGTGGGATTTCACTTCACGTTAGACGGTTTGCAGTACAATGATGATTTCA
TCGTACTTGATTTTAATGACAAATTTTGATGTCATCCTAGGGTTACCCTGGATCAGGAGGTACGAGCCAAGGGTCGGCTGGCAGCATCGACCGTGAAGAT
GCCTGCCACTTGTTCATCAGATGGCCATCTGATGAACGTCTTGGAGCGTCCACAAGCGTGTGGATATACTGCGAGTGAGTGCGATGGCCTCACTTGCGGT
ACGGTCGTTAGTACGACTGCACAAGATCACAGTGCGACAATCAATCACACTGTGGAGGAAGCTGCCGGCGGCTGTGCGGATGTACAGGAAGCGCCGAAGG
TCGGCTACTCGAACAAGTAGGGTGGATCGGTACATGGGTGTATGCCTAGCGGGAGACATCCAAGTAAGAATAAACCTGTTGCAACACGATGATCTTAGAT
CGGCTGGAGGATCGATCGTTGAGGACCTAGCTGTGGTAGCGCAACCACAGCTAGAAGACGTCAAGAGAATAAGTCCCCACGTACTTGAGGAAGAAATTCT
TCAAGCGGTTTTAGGTGAGGTAACGAGACCTCATCAGCCTGAGGGAATACGTCCCCAGCGGCCTGTGGAAAAGGGTTCCCAGGAAGAAACCGAGACCTTG
AATGTCTTGGTTAAGGAAGGGTCAAGTGTAGGCACTTATACACTTAATCTGATCGTTACTACGAAGTTGACTTCAGAGATCACTCAATTGCCAACGCTAG
AACCGAAACGTTTTATGCGAGATATGCGTAGTGGCAAGGTCAAGCAGATCTGCATACTCGTCACAGAGGACGAGTACGTGAATGAAATTCGGTCAGCAGT
AATATTTGCCGAGAACGAACGGGTTCTTAGCAGCTCATCGATGGACGAAATTGTCCTTGATGAGAAGACTCGGATTAAGCGATACAGGTCCCAACCTTGG
GAGTCGCTTCAGGTAGATCCTTTATATAAGGATTTGATCGAATTCAAGAACGTGTTCCCTGAATTCGTACCATGCGAATTGCCTAAGGATAAAGGCACTC
GAAATGAAATCGAGCTCAGACAGGGCTCGAAGTAGTGATTCCTGAAGCAGTGGCCACTGCCTCGTGAACTAGTACTTGCGATCGACAAGTTTTTTGCCGA
TCAGTTAGCTGCGGGTCATGTGAAGGAGTCAACTTCCCCTCACCGATATCCGACCTTCTGTGTACGCAAGGCCACAAGAGGATGGCGGATAGTTCACGCA
TTCAACAAGTTAAATACTGCAACGGTATCGGCTCAGACGCCGATACCGAGGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCATCATTTTGTACA
TGGATCTAATGTAATGGCTTTATTATATCCTAATGCGTGAACGGGACATCTCGTACACGGCAGTAAGCACCTTAAGTGGTATGCTCTGGGAGTGGCTAGT
AATGCCACAAAGGCTTAGCAATGCCCTTGCCACATTCAACAGATGTGTTACAGATCCGTTGAGACCGGCGCGAGACTTCGCACCGAGTTACTTCGACGAT
TTATTCTTCCATAGCCAGGCTATAGGCGGAAATCCGGACGTAGAAATTCATATAGCACACGTTCGTCAGGTTCTTACACTTATGTGCAAGCATAGGCTGT
ATGCCAACCTCAAGAAGTGTATATTCGTTGCTAGCGAAATACCACTTGTTGGGTGCATCGTGAGTAAACACGGCGTACTCCCTGATCCAGAAAAGAACAA
GGCGATTACCGACTGGCTTGTGCCAGTCGACATTGAGGGACTAAGAAAGCTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCGCTCAACTACGCTGAA
TTGACAGATCACCTCTCTCGTCTTTTAAAAAAGAATGAGAAGTGGTCATGGAACGCTGATTGTCGGCGTTCCTTTAAAGGTATCAATCAGAGCTTGATCC
AATCTCCCATCTTGTCGATTGCAGACCAATACAGATCATTCCATGTGGTTTGTAACGCCAGCAATTTTGCAATCGGCTACGCGTTAATGCAGTACGATGC
AGACGGCGCAGAGCGCGTCGTCTGTTATTAATCGCGTCAGATGGTAGCAGCTGAGCGTAATTATCCAGTGCATGACAAGGAACGCCTTGCCATGAAGTAT
GCACTGGCAAAGTTTCGCGTCTATCTTCTTGGAGTTAGGCCGTATGTATTCTATAAGGACCATGCGTCATTACGCATGGCCGTACACATCCTACACCTCT
CGCAAAGGATGGCGAGGTGGCTGTCCTACTTACAATTTCTCCGTGGAGTACAAACTCGGACGACTCAATGTCGTCGCGGACGCGTTGTCGCGCCGACCCG
ATTTCGAGTCGGCTGCACAGTCCATCAGTGGGGTTGATACCACAGTTGCAACACTAGTCATTAGTGTCCCGTCGTCAACATTTCTTGACGACATGAAAAA
TGGCCTACGCAGACGATAAGTCGCTTCTGCGACTAATGGATCATCTAGTGACTCCATCTCGTAAATCGCTCAAATATTTACCGGCCTTGTATCGATCTTC
CGCGGATCAAAACACAACATGCAACGTTGCTGTATTATACAGCCGTTGCCGGCGACACACCTCGTGTCGTCGTCCCCACTCATAATGATTTGCGCTTGCG
CATCTTGTATGAGTGCAATAGTGTACCACCTAGTAAGCATCGTGGGCATGAGAAGACTTATCTCACGGTAAGTTGCGACTTTTACTGGCCCCACCAGTAT
CAGTTCGTGCGCAAGTACATTCGTGCTTGTAGAGTTTGCCAACGAGTGAAGCCCAGTCTTCTATCCCGTGCGCCACTACAGCCTCTACCAATCCTGGCAG
AGTACTGGCAGTCCGTTTCAACAGACTTCATCTTCGGTTTCCCCGAAGCCGCTCACAAGAAAAAGGTTATTTTTTGTGTTCGTAGACCGATTCAGCAAGA
TGGTACATTTTGCTGCAGTTAATGAGTCAATCTCAGCATATGGTGGTGCCCGTGTCTTCAGTGACACGGTATTCCGACTTCATGGTCTACACCGTGAACT
AGCCTCTGATAGAGATCCTCGGATCACGGCGGTGTTTTGGCAATCTGTGTTCCGATCCCTCGGAACACGTCTAACTATGTCTACTTCTGACCATCCCGAG
ACTGATGGTCAGACAGAACGCGTCATCCGCATCTTCGAAGAGATCCTTCGAGGATACGTCAAATCTTTCACAGATTGGAGCGAATTCTTGCCGATGGTAT
AGTTTGTGATCAATAACTCCGTGCATGCGTCCACAACGCATACACCATTCTTCGTAAATGGCTTACGCCATCCACGCCTACCCTCCTATTTAAAGTCTGA
CACTAATTCAAGAAGGGGAGGGATTCGCTTGAGCAAAAACCGCTCTGGCTCTTGCTCATCACGTGTCGAGGTAACCGAAGACGCGAACGTTGCTGATGTC
GATCAAATCGACATCGAAGCTGATGATCTCAGCAATAGTGACGACACTATTGCTAAACCCAGATGAAGATGACGATGCTGGTATATTCAGCATCTCTAAT
GACTAAACCAGCGAGGATGAGAACACCCTTGCTGAAAAAGAGATGACCTCCTAGCGGTGAGCACAAGGAGAACTGCAACAAACCAAAGTAATTCAGCAGA
AGATTTCCTGCTGGCACGAGAAGCAGTGGTCCGTTTCATGCAGGAATCCATCGCTAACACGGTGAACCGGTAGAAACGGAACGCTGACAAACATGGAAGA
GCAAACATTATTCTATTTAATGTAGGAGATTTAATTCTTCTGTCTACGGTAAATTTTCCTAAGCACGTAGTAACTAATGTGGGTAGTAGTAAACTACTAC
CCAAGTTCATCGGACCGTCTCGTGTACTACATCGCAGACGCAATGCGTACACGATCGAGTTGCCTCGCAGGATGCGTACGAATCCTATGTTTTATGTAGG
TCGTCTCCGCCCGTACCATCAGCACGAGGTCTCTTCCTCGGGCGA