Description :
From Genome Similarity Track
Location :
contig_11:478210- 479925
Sequence
1715 bases(100 bases per row)
CTTTCCGAGAAGCGTTTGGCGCCCTTGGGATTCCCATGCTGGTCACCCTTGTGGTGTGCATTATGTGGACAACATGGCTCGTTATCATAGCGTTGGCACC
CAACGAAGCTGCGAATTGGTTGATGGGCACAGGCGCCTACGACGACGGCCAGTTCTGGTTGATCATCGACACAAACTCCACCATTATTAACATCGGGGCA
GTCGGACTTGTTCTTGTTGATGCATGCTACCTGTACGTTGTCGTGAAGATACTTCGCTGGCGTAAAACAGTTGATGATGCACAGCGGGTTGCTTCGTGGT
TCGAACCAGAGTCATGTGTTGCTTCGTTCCCGTACACATGGATGAATACAGCTCTTACTCGATGCAGAAACTACTACAAGGATTTAACATCCTTTCGAGG
CAGCAATCGAAAGTTTGGGTACGATTGTCTTGCAGGTATTTCCACAAAAAGACTAACCGATCATGCTATAGAATATGTGCTTGAAAGTTTTCAATTTGAC
TATGCAGATGACGGTCCTTCTTGAGCTACTGGATAGTGGTAGCCCAGCAACTCTCGTGTATGGTTATACGGCTTTTATTTCGATAGGTTCCTTGGCAGGG
GCTGTAAAAATTATCTACGGCGAATTTACGGCGATGGGAGAGGTTGTCGCCGGGTCCATGTGAGCGCTTCACAGTGTGCATTCTTTAAATTCCATCGCGT
TCTTGCTTGAATTGCTAACGCTAACACTCGATCTCTTTTGCGCAGTTTTGATTTGTTTGCAGCTATCGTTTATCCGGTGCTAGTGCTCGAGTACTGCTAT
TACAACTTCCAGCTTGACGATGCCGTTTTTGCTACATACTTAGCGATTCTTCCCCCGGGGAGCTTTGAACGAACGGCTAGGGTGTTTGCAGATGCGTCCG
AAATCGCTCTTTTCCGCGTGAATTTCGACTCTCTTCGAATACGGTCCCCTCTTGATTTCGTCCTACACACTAGCATTAACCTTTCGTTTTGCTACCGAAT
CAAGCGCATCGGGGATATTCTCGTTTCATCTCACCTCCGGCGTCTACAGTCAGTTAGAATGCAAAGGCCCAAGCCGGCAAGAAATCGCCAGAAGTCGGTT
CCGAGAGTATTCGCGAGTGCGTTTATTGCATTTAGTATCTTTGTATGGGTCTATTCCATCCAAGCTATCGAAGGCTCGCGCAAGTATTGCTCACCGTATC
CGGAGTGTGTCGTGTATGCCTACCGCTGGGGATCTAGCGGAGGGGTGTGCCCCTGCCGAATTCTCATTGATATCGACCCCTCTCCTCAAACATACAACGA
ATGGACTCACCCTGTTGACGTATATACTAACGTCCAAGCACTGGCGGTGTCCGGAGAGCTAAGGTCTCTTCAACTCACTAACCGCCAGCTTTTGGAATTA
CCTGAAGAACTTCGAGCTTGTCGCCGCCTAACGTCCATGTATGTTGTATGTTGCTTCTAGACTTGGGCTGTGGTAATTTATATACTAATGATGTACCTGT
GGTGAATAGCCGATTAATTTACACCAGCATCCAGTCCATTCCATCTTGGACAAAAGAGTTCAAGTACCTTGAGAACCTGTGCGTTCGTCAAGTTATCCTG
TGGGGTGAGATGCGATTTCTCACACATTTTTTTGCTTTAGTCATTTGGAAGGGAAGCAAGGAAGTCCAAATCTTGTGGCGCTCCCAGAAGACCTGTTCAG
CGATATGCCGTGGCT